Incidental Mutation 'R3415:Klhl42'
ID266763
Institutional Source Beutler Lab
Gene Symbol Klhl42
Ensembl Gene ENSMUSG00000040102
Gene Namekelch-like 42
SynonymsKlhdc5, C230080I20Rik
MMRRC Submission 040633-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3415 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location147091379-147112778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 147107880 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 406 (V406M)
Ref Sequence ENSEMBL: ENSMUSP00000042558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036003] [ENSMUST00000203441]
Predicted Effect probably damaging
Transcript: ENSMUST00000036003
AA Change: V406M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042558
Gene: ENSMUSG00000040102
AA Change: V406M

DomainStartEndE-ValueType
BTB 5 145 1.14e-1 SMART
low complexity region 151 164 N/A INTRINSIC
Kelch 242 289 1.79e-5 SMART
Kelch 290 332 1.25e-9 SMART
Kelch 333 379 1.56e1 SMART
Blast:Kelch 380 437 3e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000203441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203866
Meta Mutation Damage Score 0.6272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc39 C G 3: 33,814,497 L813F probably benign Het
Cdh13 A T 8: 118,675,207 D116V probably benign Het
Cep170 G T 1: 176,756,044 P923Q probably damaging Het
Chga A G 12: 102,562,784 E340G probably benign Het
Cmip T A 8: 117,349,377 probably null Het
Cnga4 A G 7: 105,407,118 Y309C probably damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Dph6 C T 2: 114,518,287 V267I probably benign Het
Ero1l T C 14: 45,287,866 T401A possibly damaging Het
Exoc6b C G 6: 84,890,565 L288F possibly damaging Het
Gm884 A T 11: 103,614,609 S2178T possibly damaging Het
Ifi203 G A 1: 173,928,760 R486* probably null Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Lims2 A T 18: 31,944,155 Y58F probably damaging Het
Lrp12 A G 15: 39,878,282 F365L probably damaging Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmp1a A T 9: 7,464,869 K34N possibly damaging Het
Olfr730 T A 14: 50,186,612 T202S possibly damaging Het
P2rx5 G T 11: 73,160,660 V22L possibly damaging Het
Pnmal1 A G 7: 16,960,954 R245G possibly damaging Het
Prpsap1 T C 11: 116,478,584 S179G probably benign Het
Specc1 A G 11: 62,118,419 T334A probably benign Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tm7sf2 A G 19: 6,063,599 Y301H probably damaging Het
Unc13c G T 9: 73,932,586 H328N probably benign Het
Zfp641 T C 15: 98,290,540 D153G probably benign Het
Zp3 A G 5: 135,985,660 T278A probably benign Het
Zscan2 T A 7: 80,875,402 S290R probably damaging Het
Other mutations in Klhl42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Klhl42 APN 6 147101733 missense probably damaging 1.00
IGL01401:Klhl42 APN 6 147107743 missense probably benign 0.03
IGL02590:Klhl42 APN 6 147092312 missense probably damaging 0.97
R0045:Klhl42 UTSW 6 147092168 missense probably benign
R1066:Klhl42 UTSW 6 147107899 missense probably benign
R1920:Klhl42 UTSW 6 147107929 missense probably damaging 1.00
R1951:Klhl42 UTSW 6 147091823 missense probably damaging 0.99
R2017:Klhl42 UTSW 6 147107793 missense probably benign 0.04
R2021:Klhl42 UTSW 6 147091896 missense possibly damaging 0.59
R2065:Klhl42 UTSW 6 147101663 missense probably damaging 1.00
R2128:Klhl42 UTSW 6 147101753 missense probably benign 0.00
R2982:Klhl42 UTSW 6 147091616 missense probably damaging 1.00
R3416:Klhl42 UTSW 6 147107880 missense probably damaging 1.00
R3417:Klhl42 UTSW 6 147107880 missense probably damaging 1.00
R4450:Klhl42 UTSW 6 147091671 missense probably benign 0.16
R4967:Klhl42 UTSW 6 147108004 missense possibly damaging 0.77
R5342:Klhl42 UTSW 6 147092286 missense possibly damaging 0.86
R5556:Klhl42 UTSW 6 147108112 missense probably benign 0.00
R6269:Klhl42 UTSW 6 147092307 missense probably damaging 1.00
R7375:Klhl42 UTSW 6 147092040 missense probably benign
R7769:Klhl42 UTSW 6 147091860 missense possibly damaging 0.95
R7848:Klhl42 UTSW 6 147108100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCAACATGAACATCCTGCAG -3'
(R):5'- ATGTCCGAAAGCTGGGAAC -3'

Sequencing Primer
(F):5'- ACATGAACATCCTGCAGTACTG -3'
(R):5'- GCTGTCAGCAAAGATGTTGTAC -3'
Posted On2015-02-18