Mutagenetix > Incidental Mutations

Incidental Mutation 'R3415:Pnmal1'

266764

Institutional Source

Beutler Lab

Gene Symbol

Pnmal1

Ensembl Gene

ENSMUSG00000041141

Gene Name

PNMA-like 1

Synonyms

MMRRC Submission

040633-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R3415 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16959679-16964607 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 16960954 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 245 (R245G)

Ref Sequence

ENSEMBL: ENSMUSP00000040929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038163]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038163
AA Change: R245G

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000040929
Gene: ENSMUSG00000041141
AA Change: R245G

Domain	Start	End	E-Value	Type
Pfam:PNMA	5	364	6.9e-108	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ccdc39	C	G	3: 33,814,497	L813F	probably benign	Het
Cdh13	A	T	8: 118,675,207	D116V	probably benign	Het
Cep170	G	T	1: 176,756,044	P923Q	probably damaging	Het
Chga	A	G	12: 102,562,784	E340G	probably benign	Het
Cmip	T	A	8: 117,349,377		probably null	Het
Cnga4	A	G	7: 105,407,118	Y309C	probably damaging	Het
Crocc	G	A	4: 141,046,447	T103I	possibly damaging	Het
Dph6	C	T	2: 114,518,287	V267I	probably benign	Het
Ero1l	T	C	14: 45,287,866	T401A	possibly damaging	Het
Exoc6b	C	G	6: 84,890,565	L288F	possibly damaging	Het
Gm884	A	T	11: 103,614,609	S2178T	possibly damaging	Het
Ifi203	G	A	1: 173,928,760	R486*	probably null	Het
Igsf9b	G	A	9: 27,309,478	V47I	possibly damaging	Het
Klhl42	G	A	6: 147,107,880	V406M	probably damaging	Het
Lims2	A	T	18: 31,944,155	Y58F	probably damaging	Het
Lrp12	A	G	15: 39,878,282	F365L	probably damaging	Het
Mark4	T	C	7: 19,451,725	D28G	probably benign	Het
Mfsd13a	C	T	19: 46,371,992	R328C	probably damaging	Het
Mmp1a	A	T	9: 7,464,869	K34N	possibly damaging	Het
Olfr730	T	A	14: 50,186,612	T202S	possibly damaging	Het
P2rx5	G	T	11: 73,160,660	V22L	possibly damaging	Het
Prpsap1	T	C	11: 116,478,584	S179G	probably benign	Het
Specc1	A	G	11: 62,118,419	T334A	probably benign	Het
Tas2r124	A	T	6: 132,755,638	R303S	probably benign	Het
Tm7sf2	A	G	19: 6,063,599	Y301H	probably damaging	Het
Unc13c	G	T	9: 73,932,586	H328N	probably benign	Het
Zfp641	T	C	15: 98,290,540	D153G	probably benign	Het
Zp3	A	G	5: 135,985,660	T278A	probably benign	Het
Zscan2	T	A	7: 80,875,402	S290R	probably damaging	Het

Other mutations in Pnmal1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
FR4737:Pnmal1	UTSW	7	16961425	small insertion	probably benign
R0116:Pnmal1	UTSW	7	16960700	missense	probably damaging	0.97
R0140:Pnmal1	UTSW	7	16960222	start codon destroyed	probably null	0.00
R1109:Pnmal1	UTSW	7	16961467	nonsense	probably null
R1306:Pnmal1	UTSW	7	16962025	missense	probably benign	0.00
R1426:Pnmal1	UTSW	7	16960984	missense	possibly damaging	0.56
R2000:Pnmal1	UTSW	7	16961039	missense	probably benign	0.01
R2404:Pnmal1	UTSW	7	16960391	missense	probably damaging	1.00
R3708:Pnmal1	UTSW	7	16960225	missense	probably damaging	1.00
R4009:Pnmal1	UTSW	7	16961376	missense	probably damaging	1.00
R4105:Pnmal1	UTSW	7	16961179	missense	possibly damaging	0.81
R5126:Pnmal1	UTSW	7	16961317	missense	probably benign	0.03
R5244:Pnmal1	UTSW	7	16961323	missense	probably damaging	0.99
R5825:Pnmal1	UTSW	7	16961095	missense	probably benign	0.01
R5931:Pnmal1	UTSW	7	16960884	missense	probably benign	0.31
R6128:Pnmal1	UTSW	7	16960736	missense	probably benign	0.00
R7337:Pnmal1	UTSW	7	16961390	missense	probably benign	0.35
R7756:Pnmal1	UTSW	7	16961299	missense	probably benign	0.27
R7758:Pnmal1	UTSW	7	16961299	missense	probably benign	0.27
RF007:Pnmal1	UTSW	7	16961424	small insertion	probably benign
RF009:Pnmal1	UTSW	7	16961427	small insertion	probably benign
RF020:Pnmal1	UTSW	7	16961451	small insertion	probably benign
RF022:Pnmal1	UTSW	7	16961427	small insertion	probably benign
RF029:Pnmal1	UTSW	7	16961444	nonsense	probably null
RF039:Pnmal1	UTSW	7	16961444	small insertion	probably benign
RF041:Pnmal1	UTSW	7	16961444	nonsense	probably null
RF046:Pnmal1	UTSW	7	16961423	small insertion	probably benign
RF047:Pnmal1	UTSW	7	16961423	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGCTGCAATCCGTAGTCG -3'
(R):5'- TCTCTTCCTGCTTCACAAAGGG -3'

Sequencing Primer
(F):5'- GCTGAGGAGGCTGCTGAG -3'
(R):5'- GCTGTTGTAATTGCTGCC -3'

Posted On

2015-02-18