Incidental Mutation 'R3415:Pnmal1'
ID266764
Institutional Source Beutler Lab
Gene Symbol Pnmal1
Ensembl Gene ENSMUSG00000041141
Gene NamePNMA-like 1
Synonyms
MMRRC Submission 040633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R3415 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location16959679-16964607 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16960954 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 245 (R245G)
Ref Sequence ENSEMBL: ENSMUSP00000040929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038163]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038163
AA Change: R245G

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040929
Gene: ENSMUSG00000041141
AA Change: R245G

DomainStartEndE-ValueType
Pfam:PNMA 5 364 6.9e-108 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc39 C G 3: 33,814,497 L813F probably benign Het
Cdh13 A T 8: 118,675,207 D116V probably benign Het
Cep170 G T 1: 176,756,044 P923Q probably damaging Het
Chga A G 12: 102,562,784 E340G probably benign Het
Cmip T A 8: 117,349,377 probably null Het
Cnga4 A G 7: 105,407,118 Y309C probably damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Dph6 C T 2: 114,518,287 V267I probably benign Het
Ero1l T C 14: 45,287,866 T401A possibly damaging Het
Exoc6b C G 6: 84,890,565 L288F possibly damaging Het
Gm884 A T 11: 103,614,609 S2178T possibly damaging Het
Ifi203 G A 1: 173,928,760 R486* probably null Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Lims2 A T 18: 31,944,155 Y58F probably damaging Het
Lrp12 A G 15: 39,878,282 F365L probably damaging Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmp1a A T 9: 7,464,869 K34N possibly damaging Het
Olfr730 T A 14: 50,186,612 T202S possibly damaging Het
P2rx5 G T 11: 73,160,660 V22L possibly damaging Het
Prpsap1 T C 11: 116,478,584 S179G probably benign Het
Specc1 A G 11: 62,118,419 T334A probably benign Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tm7sf2 A G 19: 6,063,599 Y301H probably damaging Het
Unc13c G T 9: 73,932,586 H328N probably benign Het
Zfp641 T C 15: 98,290,540 D153G probably benign Het
Zp3 A G 5: 135,985,660 T278A probably benign Het
Zscan2 T A 7: 80,875,402 S290R probably damaging Het
Other mutations in Pnmal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Pnmal1 UTSW 7 16961425 small insertion probably benign
R0116:Pnmal1 UTSW 7 16960700 missense probably damaging 0.97
R0140:Pnmal1 UTSW 7 16960222 start codon destroyed probably null 0.00
R1109:Pnmal1 UTSW 7 16961467 nonsense probably null
R1306:Pnmal1 UTSW 7 16962025 missense probably benign 0.00
R1426:Pnmal1 UTSW 7 16960984 missense possibly damaging 0.56
R2000:Pnmal1 UTSW 7 16961039 missense probably benign 0.01
R2404:Pnmal1 UTSW 7 16960391 missense probably damaging 1.00
R3708:Pnmal1 UTSW 7 16960225 missense probably damaging 1.00
R4009:Pnmal1 UTSW 7 16961376 missense probably damaging 1.00
R4105:Pnmal1 UTSW 7 16961179 missense possibly damaging 0.81
R5126:Pnmal1 UTSW 7 16961317 missense probably benign 0.03
R5244:Pnmal1 UTSW 7 16961323 missense probably damaging 0.99
R5825:Pnmal1 UTSW 7 16961095 missense probably benign 0.01
R5931:Pnmal1 UTSW 7 16960884 missense probably benign 0.31
R6128:Pnmal1 UTSW 7 16960736 missense probably benign 0.00
R7337:Pnmal1 UTSW 7 16961390 missense probably benign 0.35
R7756:Pnmal1 UTSW 7 16961299 missense probably benign 0.27
R7758:Pnmal1 UTSW 7 16961299 missense probably benign 0.27
RF007:Pnmal1 UTSW 7 16961424 small insertion probably benign
RF009:Pnmal1 UTSW 7 16961427 small insertion probably benign
RF020:Pnmal1 UTSW 7 16961451 small insertion probably benign
RF022:Pnmal1 UTSW 7 16961427 small insertion probably benign
RF029:Pnmal1 UTSW 7 16961444 nonsense probably null
RF039:Pnmal1 UTSW 7 16961444 small insertion probably benign
RF041:Pnmal1 UTSW 7 16961444 nonsense probably null
RF046:Pnmal1 UTSW 7 16961423 small insertion probably benign
RF047:Pnmal1 UTSW 7 16961423 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTGCAATCCGTAGTCG -3'
(R):5'- TCTCTTCCTGCTTCACAAAGGG -3'

Sequencing Primer
(F):5'- GCTGAGGAGGCTGCTGAG -3'
(R):5'- GCTGTTGTAATTGCTGCC -3'
Posted On2015-02-18