Incidental Mutation 'R3415:P2rx5'
ID266775
Institutional Source Beutler Lab
Gene Symbol P2rx5
Ensembl Gene ENSMUSG00000005950
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 5
SynonymsP2X5
MMRRC Submission 040633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3415 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73160421-73172685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 73160660 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 22 (V22L)
Ref Sequence ENSEMBL: ENSMUSP00000006104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006104] [ENSMUST00000135202] [ENSMUST00000136894]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006104
AA Change: V22L

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006104
Gene: ENSMUSG00000005950
AA Change: V22L

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 382 2.1e-161 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000135202
AA Change: V22L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118448
Gene: ENSMUSG00000005950
AA Change: V22L

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 307 1.8e-120 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000136894
AA Change: V22L

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121834
Gene: ENSMUSG00000005950
AA Change: V22L

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 331 2.9e-144 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream gene, TAX1BP3 (Tax1 binding protein 3). [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous mutant mice exhibit decreased peripheral blood CD8+ lymphocytes and elevated NK cells. Impaired learning/memory during trace aversive conditioning and increased exploratory behavior during open field testing is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc39 C G 3: 33,814,497 L813F probably benign Het
Cdh13 A T 8: 118,675,207 D116V probably benign Het
Cep170 G T 1: 176,756,044 P923Q probably damaging Het
Chga A G 12: 102,562,784 E340G probably benign Het
Cmip T A 8: 117,349,377 probably null Het
Cnga4 A G 7: 105,407,118 Y309C probably damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Dph6 C T 2: 114,518,287 V267I probably benign Het
Ero1l T C 14: 45,287,866 T401A possibly damaging Het
Exoc6b C G 6: 84,890,565 L288F possibly damaging Het
Gm884 A T 11: 103,614,609 S2178T possibly damaging Het
Ifi203 G A 1: 173,928,760 R486* probably null Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Lims2 A T 18: 31,944,155 Y58F probably damaging Het
Lrp12 A G 15: 39,878,282 F365L probably damaging Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmp1a A T 9: 7,464,869 K34N possibly damaging Het
Olfr730 T A 14: 50,186,612 T202S possibly damaging Het
Pnmal1 A G 7: 16,960,954 R245G possibly damaging Het
Prpsap1 T C 11: 116,478,584 S179G probably benign Het
Specc1 A G 11: 62,118,419 T334A probably benign Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tm7sf2 A G 19: 6,063,599 Y301H probably damaging Het
Unc13c G T 9: 73,932,586 H328N probably benign Het
Zfp641 T C 15: 98,290,540 D153G probably benign Het
Zp3 A G 5: 135,985,660 T278A probably benign Het
Zscan2 T A 7: 80,875,402 S290R probably damaging Het
Other mutations in P2rx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:P2rx5 APN 11 73167492 critical splice acceptor site probably null
IGL01860:P2rx5 APN 11 73165559 missense probably damaging 0.98
IGL02019:P2rx5 APN 11 73167977 splice site probably benign
IGL03079:P2rx5 APN 11 73164888 missense possibly damaging 0.92
IGL03088:P2rx5 APN 11 73165620 splice site probably benign
R0014:P2rx5 UTSW 11 73167062 splice site probably benign
R0845:P2rx5 UTSW 11 73165574 missense probably damaging 1.00
R1384:P2rx5 UTSW 11 73167890 missense probably damaging 1.00
R4155:P2rx5 UTSW 11 73171829 missense probably damaging 0.96
R4641:P2rx5 UTSW 11 73167564 missense possibly damaging 0.58
R4750:P2rx5 UTSW 11 73164877 missense probably damaging 1.00
R4854:P2rx5 UTSW 11 73171779 missense probably benign 0.23
R5186:P2rx5 UTSW 11 73171790 missense possibly damaging 0.68
R7003:P2rx5 UTSW 11 73167974 critical splice donor site probably null
R7141:P2rx5 UTSW 11 73160648 missense probably damaging 1.00
R7312:P2rx5 UTSW 11 73164866 missense probably damaging 1.00
X0004:P2rx5 UTSW 11 73166989 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAAGCACCTTCCCCTTC -3'
(R):5'- TACATCCACGGGCTTTAAGG -3'

Sequencing Primer
(F):5'- TGGTGTCACCGTGTCAGC -3'
(R):5'- TTTAAGGCTGACTCCCCCAAGG -3'
Posted On2015-02-18