Incidental Mutation 'R3416:Strbp'
ID266791
Institutional Source Beutler Lab
Gene Symbol Strbp
Ensembl Gene ENSMUSG00000026915
Gene Namespermatid perinuclear RNA binding protein
Synonyms6430510M02Rik, Spnr, C230082I21Rik
MMRRC Submission 040634-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.452) question?
Stock #R3416 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location37483228-37703859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 37590725 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Threonine at position 610 (R610T)
Ref Sequence ENSEMBL: ENSMUSP00000139145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028279] [ENSMUST00000072186] [ENSMUST00000183690]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028279
AA Change: R610T

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028279
Gene: ENSMUSG00000026915
AA Change: R610T

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000072186
AA Change: R610T

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072047
Gene: ENSMUSG00000026915
AA Change: R610T

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183690
AA Change: R610T

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139145
Gene: ENSMUSG00000026915
AA Change: R610T

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203861
Predicted Effect probably benign
Transcript: ENSMUST00000204569
Meta Mutation Damage Score 0.0768 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap insertion exhibit premature death, a reduced body size and an abnormal clutching reflex. Minor brain abnormalities and spermatogenesis defects were also noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik T C 10: 83,759,632 probably null Het
Abi1 T C 2: 23,040,002 S22G probably damaging Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Adnp2 T C 18: 80,128,158 E1012G possibly damaging Het
Azin1 A T 15: 38,493,546 S278T possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyb561d2 A G 9: 107,540,126 L142P probably damaging Het
Cyhr1 A T 15: 76,658,715 probably null Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Fryl T C 5: 73,108,074 Q510R possibly damaging Het
Gfra1 T C 19: 58,267,112 Y301C probably damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mycs C T X: 5,468,756 S90N possibly damaging Het
Olfr508 G A 7: 108,630,018 V9I possibly damaging Het
Pcdha8 A T 18: 36,992,630 Q55L probably benign Het
Pkhd1l1 A G 15: 44,547,364 T2756A probably damaging Het
Prl8a8 A T 13: 27,511,549 C71S probably damaging Het
Ralgapa1 T A 12: 55,770,613 probably benign Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn4a A T 11: 106,330,413 S807T probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Smg1 G C 7: 118,148,853 probably benign Het
Spata1 A T 3: 146,487,508 probably benign Het
Susd5 A G 9: 114,095,658 D203G possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tha1 T C 11: 117,873,200 D67G possibly damaging Het
Vmn2r120 T A 17: 57,509,241 I705F possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zan T A 5: 137,435,720 E2250D unknown Het
Zfp560 A T 9: 20,347,678 Y629* probably null Het
Other mutations in Strbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Strbp APN 2 37586504 splice site probably benign
IGL00656:Strbp APN 2 37603138 splice site probably benign
IGL01376:Strbp APN 2 37645651 missense probably damaging 1.00
IGL01998:Strbp APN 2 37625285 missense probably damaging 1.00
IGL02347:Strbp APN 2 37645648 missense probably benign 0.25
IGL02453:Strbp APN 2 37586508 critical splice donor site probably null
IGL02804:Strbp APN 2 37624486 splice site probably benign
IGL03102:Strbp APN 2 37586503 splice site probably benign
PIT4418001:Strbp UTSW 2 37645492 missense probably benign
R0382:Strbp UTSW 2 37600826 missense probably benign 0.00
R0575:Strbp UTSW 2 37640873 missense possibly damaging 0.87
R0610:Strbp UTSW 2 37584077 missense probably damaging 0.97
R0825:Strbp UTSW 2 37635527 missense probably benign 0.00
R1829:Strbp UTSW 2 37640909 missense possibly damaging 0.63
R1831:Strbp UTSW 2 37625265 missense possibly damaging 0.71
R3417:Strbp UTSW 2 37590725 missense possibly damaging 0.94
R4673:Strbp UTSW 2 37645679 missense probably damaging 1.00
R5093:Strbp UTSW 2 37627487 missense probably damaging 0.99
R5099:Strbp UTSW 2 37603018 missense probably damaging 0.98
R5269:Strbp UTSW 2 37627443 missense possibly damaging 0.87
R5378:Strbp UTSW 2 37599174 missense probably damaging 1.00
R5378:Strbp UTSW 2 37600806 missense probably benign 0.03
R5454:Strbp UTSW 2 37645483 missense probably benign 0.00
R5905:Strbp UTSW 2 37625255 missense probably damaging 1.00
R6028:Strbp UTSW 2 37625255 missense probably damaging 1.00
R6374:Strbp UTSW 2 37603008 missense probably damaging 1.00
R6700:Strbp UTSW 2 37603963 missense probably null 0.01
R6800:Strbp UTSW 2 37625216 missense probably damaging 1.00
R7032:Strbp UTSW 2 37603113 missense possibly damaging 0.92
R7139:Strbp UTSW 2 37624502 missense probably benign 0.00
R7261:Strbp UTSW 2 37641137 intron probably null
R7481:Strbp UTSW 2 37600754 missense probably benign 0.02
R7718:Strbp UTSW 2 37625282 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTATAGTTACTTAGCAGATCCC -3'
(R):5'- TTTGCAGATGGTCAACTGAAGAG -3'

Sequencing Primer
(F):5'- TCTATATACTCCTACACATGTGCAG -3'
(R):5'- TGGTCAACTGAAGAGACTAACTATAG -3'
Posted On2015-02-18