Incidental Mutation 'R3416:Spata1'
ID266794
Institutional Source Beutler Lab
Gene Symbol Spata1
Ensembl Gene ENSMUSG00000028188
Gene Namespermatogenesis associated 1
SynonymsSP-2, 4921536I21Rik
MMRRC Submission 040634-MU
Accession Numbers

Genbank: NM_027617

Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R3416 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146457196-146499753 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 146487508 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029839] [ENSMUST00000093951] [ENSMUST00000197980]
Predicted Effect probably benign
Transcript: ENSMUST00000029839
SMART Domains Protein: ENSMUSP00000029839
Gene: ENSMUSG00000028188

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:SPATA1_C 279 428 1.7e-56 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000093951
AA Change: C107S
SMART Domains Protein: ENSMUSP00000091483
Gene: ENSMUSG00000028188
AA Change: C107S

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197684
Predicted Effect probably benign
Transcript: ENSMUST00000197980
SMART Domains Protein: ENSMUSP00000142800
Gene: ENSMUSG00000028188

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
SCOP:d1eq1a_ 267 365 8e-5 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik T C 10: 83,759,632 probably null Het
Abi1 T C 2: 23,040,002 S22G probably damaging Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Adnp2 T C 18: 80,128,158 E1012G possibly damaging Het
Azin1 A T 15: 38,493,546 S278T possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyb561d2 A G 9: 107,540,126 L142P probably damaging Het
Cyhr1 A T 15: 76,658,715 probably null Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Fryl T C 5: 73,108,074 Q510R possibly damaging Het
Gfra1 T C 19: 58,267,112 Y301C probably damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mycs C T X: 5,468,756 S90N possibly damaging Het
Olfr508 G A 7: 108,630,018 V9I possibly damaging Het
Pcdha8 A T 18: 36,992,630 Q55L probably benign Het
Pkhd1l1 A G 15: 44,547,364 T2756A probably damaging Het
Prl8a8 A T 13: 27,511,549 C71S probably damaging Het
Ralgapa1 T A 12: 55,770,613 probably benign Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn4a A T 11: 106,330,413 S807T probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Smg1 G C 7: 118,148,853 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Susd5 A G 9: 114,095,658 D203G possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tha1 T C 11: 117,873,200 D67G possibly damaging Het
Vmn2r120 T A 17: 57,509,241 I705F possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zan T A 5: 137,435,720 E2250D unknown Het
Zfp560 A T 9: 20,347,678 Y629* probably null Het
Other mutations in Spata1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Spata1 APN 3 146476242 missense possibly damaging 0.94
IGL01306:Spata1 APN 3 146487399 nonsense probably null
IGL01537:Spata1 APN 3 146489803 splice site probably benign
IGL02363:Spata1 APN 3 146487364 missense possibly damaging 0.96
IGL02873:Spata1 APN 3 146487367 missense possibly damaging 0.86
IGL02898:Spata1 APN 3 146475339 missense possibly damaging 0.71
IGL03071:Spata1 APN 3 146475334 missense possibly damaging 0.93
IGL03204:Spata1 APN 3 146488679 missense probably benign 0.18
ANU23:Spata1 UTSW 3 146487399 nonsense probably null
H8930:Spata1 UTSW 3 146487271 nonsense probably null
R0414:Spata1 UTSW 3 146476188 splice site probably null
R1109:Spata1 UTSW 3 146475298 missense possibly damaging 0.51
R1742:Spata1 UTSW 3 146469623 critical splice donor site probably null
R1816:Spata1 UTSW 3 146481207 missense probably damaging 0.98
R2006:Spata1 UTSW 3 146493683 missense probably benign 0.18
R2851:Spata1 UTSW 3 146487540 missense possibly damaging 0.96
R2852:Spata1 UTSW 3 146487540 missense possibly damaging 0.96
R3911:Spata1 UTSW 3 146475324 missense probably damaging 0.99
R4856:Spata1 UTSW 3 146469774 missense probably damaging 0.99
R4859:Spata1 UTSW 3 146469774 missense probably damaging 0.99
R4886:Spata1 UTSW 3 146469774 missense probably damaging 0.99
R6902:Spata1 UTSW 3 146475323 missense possibly damaging 0.77
R7459:Spata1 UTSW 3 146476222 missense possibly damaging 0.86
R7532:Spata1 UTSW 3 146468191 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CTGTAGATTGTTCCATTAATCTCCG -3'
(R):5'- CTCTGTGATCCAGCCATAGTTG -3'

Sequencing Primer
(F):5'- ACTCTCCTGTTCATCTAAAGTAACTG -3'
(R):5'- GATCCAGCCATAGTTGCTTTTATTG -3'
Posted On2015-02-18