Incidental Mutation 'R3416:Adgrl2'
ID266795
Institutional Source Beutler Lab
Gene Symbol Adgrl2
Ensembl Gene ENSMUSG00000028184
Gene Nameadhesion G protein-coupled receptor L2
SynonymsLec1, Lphn2, Lphh1
MMRRC Submission 040634-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3416 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location148815583-148990555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148859329 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 201 (Y201C)
Ref Sequence ENSEMBL: ENSMUSP00000142336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106128] [ENSMUST00000195988] [ENSMUST00000196526] [ENSMUST00000197567] [ENSMUST00000198779] [ENSMUST00000199059] [ENSMUST00000199238] [ENSMUST00000199750] [ENSMUST00000200154] [ENSMUST00000200543]
Predicted Effect probably damaging
Transcript: ENSMUST00000106128
AA Change: Y205C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101734
Gene: ENSMUSG00000028184
AA Change: Y205C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.3e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 4.6e-69 PFAM
Pfam:Latrophilin 1128 1487 6.4e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195988
AA Change: Y205C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143444
Gene: ENSMUSG00000028184
AA Change: Y205C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.3e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.1e-66 PFAM
Pfam:Latrophilin 1119 1189 2.2e-28 PFAM
Pfam:Latrophilin 1184 1435 5.5e-123 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196526
AA Change: Y201C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143788
Gene: ENSMUSG00000028184
AA Change: Y201C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 8.7e-24 PFAM
OLF 138 394 3.4e-142 SMART
HormR 465 530 2e-22 SMART
Pfam:GAIN 533 747 1.1e-54 PFAM
GPS 771 823 2.2e-27 SMART
Pfam:7tm_2 831 1067 6.5e-68 PFAM
Pfam:Latrophilin 1087 1158 9.9e-36 PFAM
low complexity region 1163 1173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197567
AA Change: Y205C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143626
Gene: ENSMUSG00000028184
AA Change: Y205C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 1.9e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.1e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 6.4e-69 PFAM
Pfam:Latrophilin 1128 1487 2.8e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198779
AA Change: Y205C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142347
Gene: ENSMUSG00000028184
AA Change: Y205C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1084 1.8e-66 PFAM
Pfam:Latrophilin 1104 1452 7e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199059
AA Change: Y205C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143150
Gene: ENSMUSG00000028184
AA Change: Y205C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.3e-66 PFAM
Pfam:Latrophilin 1119 1467 7.1e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199238
AA Change: Y205C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142405
Gene: ENSMUSG00000028184
AA Change: Y205C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.4e-66 PFAM
Pfam:Latrophilin 1119 1478 1.6e-187 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199750
AA Change: Y205C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143320
Gene: ENSMUSG00000028184
AA Change: Y205C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.1e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 403 468 1.9e-22 SMART
GPS 709 761 2.1e-27 SMART
Pfam:7tm_2 769 1005 1.6e-66 PFAM
Pfam:Latrophilin 1025 1095 2e-28 PFAM
Pfam:Latrophilin 1090 1341 4.9e-123 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200154
AA Change: Y201C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142865
Gene: ENSMUSG00000028184
AA Change: Y201C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.2e-66 PFAM
Pfam:Latrophilin 1087 1123 2.2e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200543
AA Change: Y201C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142336
Gene: ENSMUSG00000028184
AA Change: Y201C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.2e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.7e-66 PFAM
Pfam:Latrophilin 1087 1157 2.1e-28 PFAM
Pfam:Latrophilin 1152 1403 5.3e-123 PFAM
Meta Mutation Damage Score 0.8876 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors. The encoded protein participates in the regulation of exocytosis. The proprotein is thought to be further cleaved within a cysteine-rich G-protein-coupled receptor proteolysis site into two chains that are non-covalently bound at the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice die prenatally at fetal stages. Heterozygous mice exhibit decreased locomotor activity in an open field test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik T C 10: 83,759,632 probably null Het
Abi1 T C 2: 23,040,002 S22G probably damaging Het
Adnp2 T C 18: 80,128,158 E1012G possibly damaging Het
Azin1 A T 15: 38,493,546 S278T possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyb561d2 A G 9: 107,540,126 L142P probably damaging Het
Cyhr1 A T 15: 76,658,715 probably null Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Fryl T C 5: 73,108,074 Q510R possibly damaging Het
Gfra1 T C 19: 58,267,112 Y301C probably damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mycs C T X: 5,468,756 S90N possibly damaging Het
Olfr508 G A 7: 108,630,018 V9I possibly damaging Het
Pcdha8 A T 18: 36,992,630 Q55L probably benign Het
Pkhd1l1 A G 15: 44,547,364 T2756A probably damaging Het
Prl8a8 A T 13: 27,511,549 C71S probably damaging Het
Ralgapa1 T A 12: 55,770,613 probably benign Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn4a A T 11: 106,330,413 S807T probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Smg1 G C 7: 118,148,853 probably benign Het
Spata1 A T 3: 146,487,508 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Susd5 A G 9: 114,095,658 D203G possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tha1 T C 11: 117,873,200 D67G possibly damaging Het
Vmn2r120 T A 17: 57,509,241 I705F possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zan T A 5: 137,435,720 E2250D unknown Het
Zfp560 A T 9: 20,347,678 Y629* probably null Het
Other mutations in Adgrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Adgrl2 APN 3 148865608 missense probably damaging 0.99
IGL00572:Adgrl2 APN 3 148826498 missense probably damaging 1.00
IGL01624:Adgrl2 APN 3 148836527 missense probably damaging 1.00
IGL01796:Adgrl2 APN 3 148858975 missense probably damaging 1.00
IGL02380:Adgrl2 APN 3 148828489 nonsense probably null
IGL02468:Adgrl2 APN 3 148890480 missense probably damaging 1.00
IGL02708:Adgrl2 APN 3 148826525 missense probably damaging 0.96
IGL02869:Adgrl2 APN 3 148890605 missense probably damaging 1.00
IGL03248:Adgrl2 APN 3 148817400 missense probably damaging 1.00
IGL03343:Adgrl2 APN 3 148859380 missense probably damaging 0.98
P0157:Adgrl2 UTSW 3 148859063 missense probably damaging 1.00
PIT4382001:Adgrl2 UTSW 3 148817298 missense
PIT4544001:Adgrl2 UTSW 3 148890521 missense probably damaging 1.00
R0165:Adgrl2 UTSW 3 148852863 splice site probably benign
R0242:Adgrl2 UTSW 3 148839185 unclassified probably null
R0242:Adgrl2 UTSW 3 148839185 unclassified probably null
R0344:Adgrl2 UTSW 3 148865595 splice site probably null
R0488:Adgrl2 UTSW 3 148846905 missense probably damaging 1.00
R0542:Adgrl2 UTSW 3 148859218 missense probably damaging 1.00
R0630:Adgrl2 UTSW 3 148839244 missense probably damaging 0.98
R0674:Adgrl2 UTSW 3 148837679 missense possibly damaging 0.91
R1401:Adgrl2 UTSW 3 148822981 missense probably damaging 0.99
R1543:Adgrl2 UTSW 3 148859273 missense probably damaging 1.00
R1575:Adgrl2 UTSW 3 148852762 missense probably benign 0.17
R1645:Adgrl2 UTSW 3 148865608 missense probably damaging 1.00
R1780:Adgrl2 UTSW 3 148852593 missense probably damaging 1.00
R1992:Adgrl2 UTSW 3 148817244 missense possibly damaging 0.89
R2014:Adgrl2 UTSW 3 148826475 missense probably damaging 1.00
R2130:Adgrl2 UTSW 3 148890488 missense probably damaging 0.99
R2131:Adgrl2 UTSW 3 148890488 missense probably damaging 0.99
R2400:Adgrl2 UTSW 3 148851934 missense probably damaging 1.00
R2997:Adgrl2 UTSW 3 148817649 missense probably damaging 1.00
R3161:Adgrl2 UTSW 3 148817551 missense probably damaging 1.00
R3417:Adgrl2 UTSW 3 148859329 missense probably damaging 1.00
R3551:Adgrl2 UTSW 3 148858963 missense probably damaging 1.00
R3760:Adgrl2 UTSW 3 148817235 missense probably damaging 1.00
R4355:Adgrl2 UTSW 3 148839152 missense probably damaging 1.00
R4850:Adgrl2 UTSW 3 148859020 missense probably damaging 1.00
R4911:Adgrl2 UTSW 3 148890463 missense probably damaging 0.99
R4945:Adgrl2 UTSW 3 148823036 missense probably damaging 0.99
R5313:Adgrl2 UTSW 3 148823713 missense probably damaging 1.00
R5339:Adgrl2 UTSW 3 148817844 missense probably benign 0.01
R5540:Adgrl2 UTSW 3 148837562 critical splice donor site probably null
R5583:Adgrl2 UTSW 3 148859164 missense probably damaging 1.00
R5890:Adgrl2 UTSW 3 148859175 missense probably damaging 1.00
R6170:Adgrl2 UTSW 3 148823009 missense probably damaging 1.00
R6197:Adgrl2 UTSW 3 148858942 missense probably damaging 1.00
R6284:Adgrl2 UTSW 3 148826507 missense probably damaging 1.00
R6877:Adgrl2 UTSW 3 148817286 missense probably damaging 1.00
R7048:Adgrl2 UTSW 3 148846929 missense probably damaging 1.00
R7205:Adgrl2 UTSW 3 148858949 missense probably damaging 1.00
R7326:Adgrl2 UTSW 3 148846870 missense probably benign 0.00
R7348:Adgrl2 UTSW 3 148817766 missense
R7382:Adgrl2 UTSW 3 148817283 missense
R7486:Adgrl2 UTSW 3 148817694 missense
R7498:Adgrl2 UTSW 3 148859216 nonsense probably null
R7644:Adgrl2 UTSW 3 148839153 missense probably damaging 1.00
R7690:Adgrl2 UTSW 3 148817298 missense
R7742:Adgrl2 UTSW 3 148836428 missense probably damaging 1.00
R7745:Adgrl2 UTSW 3 148836458 missense probably damaging 1.00
R8291:Adgrl2 UTSW 3 148850918 missense possibly damaging 0.93
RF007:Adgrl2 UTSW 3 148839248 missense probably damaging 1.00
X0009:Adgrl2 UTSW 3 148852654 missense probably damaging 1.00
X0019:Adgrl2 UTSW 3 148865594 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCACTGCGAGGTCAATGTC -3'
(R):5'- GTCCTGGAACCTTGAAAGCAATTG -3'

Sequencing Primer
(F):5'- ACTGCGAGGTCAATGTCTGTCTTC -3'
(R):5'- CCTTGAAAGCAATTGTGGACTCAC -3'
Posted On2015-02-18