Incidental Mutation 'R3416:Tas2r124'
ID266799
Institutional Source Beutler Lab
Gene Symbol Tas2r124
Ensembl Gene ENSMUSG00000060412
Gene Nametaste receptor, type 2, member 124
SynonymsT2R24, mGR24, mt2r50, Tas2r24
MMRRC Submission 040634-MU
Accession Numbers

NCBI RefSeq: NM_207026.1; MGI:2681267

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R3416 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location132754730-132755659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132755638 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 303 (R303S)
Ref Sequence ENSEMBL: ENSMUSP00000075509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076150]
Predicted Effect probably benign
Transcript: ENSMUST00000076150
AA Change: R303S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000075509
Gene: ENSMUSG00000060412
AA Change: R303S

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 2.3e-92 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik T C 10: 83,759,632 probably null Het
Abi1 T C 2: 23,040,002 S22G probably damaging Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Adnp2 T C 18: 80,128,158 E1012G possibly damaging Het
Azin1 A T 15: 38,493,546 S278T possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyb561d2 A G 9: 107,540,126 L142P probably damaging Het
Cyhr1 A T 15: 76,658,715 probably null Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Fryl T C 5: 73,108,074 Q510R possibly damaging Het
Gfra1 T C 19: 58,267,112 Y301C probably damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mycs C T X: 5,468,756 S90N possibly damaging Het
Olfr508 G A 7: 108,630,018 V9I possibly damaging Het
Pcdha8 A T 18: 36,992,630 Q55L probably benign Het
Pkhd1l1 A G 15: 44,547,364 T2756A probably damaging Het
Prl8a8 A T 13: 27,511,549 C71S probably damaging Het
Ralgapa1 T A 12: 55,770,613 probably benign Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn4a A T 11: 106,330,413 S807T probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Smg1 G C 7: 118,148,853 probably benign Het
Spata1 A T 3: 146,487,508 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Susd5 A G 9: 114,095,658 D203G possibly damaging Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tha1 T C 11: 117,873,200 D67G possibly damaging Het
Vmn2r120 T A 17: 57,509,241 I705F possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zan T A 5: 137,435,720 E2250D unknown Het
Zfp560 A T 9: 20,347,678 Y629* probably null Het
Other mutations in Tas2r124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Tas2r124 APN 6 132755529 missense probably benign 0.02
IGL01343:Tas2r124 APN 6 132755415 missense probably damaging 1.00
IGL01646:Tas2r124 APN 6 132755369 missense probably damaging 0.98
IGL01743:Tas2r124 APN 6 132754835 missense probably benign 0.01
IGL02251:Tas2r124 APN 6 132755561 missense probably benign 0.02
IGL03081:Tas2r124 APN 6 132755534 missense possibly damaging 0.61
IGL03309:Tas2r124 APN 6 132754935 missense probably benign 0.01
IGL03374:Tas2r124 APN 6 132755118 missense probably benign 0.00
P0012:Tas2r124 UTSW 6 132755540 missense possibly damaging 0.70
R1450:Tas2r124 UTSW 6 132755056 missense probably damaging 1.00
R1804:Tas2r124 UTSW 6 132755525 missense probably benign 0.11
R2048:Tas2r124 UTSW 6 132754895 missense possibly damaging 0.94
R2846:Tas2r124 UTSW 6 132755267 missense possibly damaging 0.73
R3415:Tas2r124 UTSW 6 132755638 missense probably benign 0.00
R3417:Tas2r124 UTSW 6 132755638 missense probably benign 0.00
R4306:Tas2r124 UTSW 6 132754991 missense probably benign 0.03
R4308:Tas2r124 UTSW 6 132754991 missense probably benign 0.03
R4823:Tas2r124 UTSW 6 132755546 missense probably damaging 0.98
R4867:Tas2r124 UTSW 6 132755193 missense probably damaging 0.98
R4949:Tas2r124 UTSW 6 132754895 missense possibly damaging 0.94
R5242:Tas2r124 UTSW 6 132755540 missense possibly damaging 0.70
R6001:Tas2r124 UTSW 6 132755453 missense probably damaging 0.99
R6263:Tas2r124 UTSW 6 132754904 missense probably benign 0.45
R6313:Tas2r124 UTSW 6 132755447 missense probably benign 0.00
R6394:Tas2r124 UTSW 6 132755076 missense probably damaging 1.00
R7685:Tas2r124 UTSW 6 132755093 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTTATATCATGGGTTGCTCAGAAG -3'
(R):5'- ACCCTTAGTCAGTGAGATAGTTTGAC -3'

Sequencing Primer
(F):5'- TTGCTCAGAAGAATCAAAGTGAACTG -3'
(R):5'- ACTGATACTCCAGGGGAATGCC -3'
Posted On2015-02-18