Incidental Mutation 'R3416:Smg1'
ID 266803
Institutional Source Beutler Lab
Gene Symbol Smg1
Ensembl Gene ENSMUSG00000030655
Gene Name SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Synonyms 2610207I05Rik, 5430435M13Rik, C130002K18Rik
MMRRC Submission 040634-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3416 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 118131308-118243670 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) G to C at 118148853 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000032891]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000032891
AA Change: I2889M
SMART Domains Protein: ENSMUSP00000032891
Gene: ENSMUSG00000030655
AA Change: I2889M

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
SCOP:d1gw5a_ 147 621 7e-7 SMART
Pfam:SMG1 629 1240 9.8e-249 PFAM
low complexity region 1540 1551 N/A INTRINSIC
SCOP:d1gw5a_ 1680 1942 8e-3 SMART
low complexity region 2125 2141 N/A INTRINSIC
PI3Kc 2149 2493 7.93e-50 SMART
low complexity region 2759 2770 N/A INTRINSIC
low complexity region 3425 3442 N/A INTRINSIC
FATC 3626 3658 8.66e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083940
Predicted Effect probably benign
Transcript: ENSMUST00000179331
SMART Domains Protein: ENSMUSP00000137592
Gene: ENSMUSG00000030655

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 71 545 1e-6 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
low complexity region 898 915 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 2049 2065 N/A INTRINSIC
PI3Kc 2073 2417 7.93e-50 SMART
low complexity region 2683 2694 N/A INTRINSIC
low complexity region 3349 3366 N/A INTRINSIC
FATC 3550 3582 8.66e-12 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early embryonic lethality. Mice heteroygous for a gene trap allele exhibit abnormal tooth development, chronic inflammation, increased body weight, increased incidence of tumor formation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik T C 10: 83,759,632 (GRCm38) probably null Het
Abi1 T C 2: 23,040,002 (GRCm38) S22G probably damaging Het
Adgrl2 T C 3: 148,859,329 (GRCm38) Y201C probably damaging Het
Adnp2 T C 18: 80,128,158 (GRCm38) E1012G possibly damaging Het
Azin1 A T 15: 38,493,546 (GRCm38) S278T possibly damaging Het
Crocc G A 4: 141,046,447 (GRCm38) T103I possibly damaging Het
Cyb561d2 A G 9: 107,540,126 (GRCm38) L142P probably damaging Het
Cyp4f39 T C 17: 32,489,742 (GRCm38) V421A possibly damaging Het
Fryl T C 5: 73,108,074 (GRCm38) Q510R possibly damaging Het
Gfra1 T C 19: 58,267,112 (GRCm38) Y301C probably damaging Het
Igsf9b G A 9: 27,309,478 (GRCm38) V47I possibly damaging Het
Klhl42 G A 6: 147,107,880 (GRCm38) V406M probably damaging Het
Mfsd13a C T 19: 46,371,992 (GRCm38) R328C probably damaging Het
Mycs C T X: 5,468,756 (GRCm38) S90N possibly damaging Het
Or5p80 G A 7: 108,630,018 (GRCm38) V9I possibly damaging Het
Pcdha8 A T 18: 36,992,630 (GRCm38) Q55L probably benign Het
Pkhd1l1 A G 15: 44,547,364 (GRCm38) T2756A probably damaging Het
Prl8a8 A T 13: 27,511,549 (GRCm38) C71S probably damaging Het
Ralgapa1 T A 12: 55,770,613 (GRCm38) probably benign Het
Rtl4 C T X: 145,119,905 (GRCm38) Q108* probably null Het
Scn4a A T 11: 106,330,413 (GRCm38) S807T probably benign Het
Sla2 G A 2: 156,875,942 (GRCm38) R137C probably damaging Het
Spata1 A T 3: 146,487,508 (GRCm38) probably benign Het
Strbp C G 2: 37,590,725 (GRCm38) R610T possibly damaging Het
Susd5 A G 9: 114,095,658 (GRCm38) D203G possibly damaging Het
Tas2r124 A T 6: 132,755,638 (GRCm38) R303S probably benign Het
Tgm3 G A 2: 130,047,772 (GRCm38) V629M possibly damaging Het
Tha1 T C 11: 117,873,200 (GRCm38) D67G possibly damaging Het
Vmn2r120 T A 17: 57,509,241 (GRCm38) I705F possibly damaging Het
Vrk3 C T 7: 44,775,442 (GRCm38) T427M probably benign Het
Zan T A 5: 137,435,720 (GRCm38) E2250D unknown Het
Zfp560 A T 9: 20,347,678 (GRCm38) Y629* probably null Het
Zftraf1 A T 15: 76,658,715 (GRCm38) probably null Het
Other mutations in Smg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Smg1 APN 7 118,198,271 (GRCm38) utr 3 prime probably benign
IGL00481:Smg1 APN 7 118,210,794 (GRCm38) missense possibly damaging 0.67
IGL00503:Smg1 APN 7 118,185,483 (GRCm38) utr 3 prime probably benign
IGL00927:Smg1 APN 7 118,140,632 (GRCm38) missense probably damaging 1.00
IGL01333:Smg1 APN 7 118,163,378 (GRCm38) splice site probably benign
IGL01344:Smg1 APN 7 118,190,836 (GRCm38) utr 3 prime probably benign
IGL01397:Smg1 APN 7 118,163,221 (GRCm38) utr 3 prime probably benign
IGL01403:Smg1 APN 7 118,158,132 (GRCm38) utr 3 prime probably benign
IGL01573:Smg1 APN 7 118,167,962 (GRCm38) utr 3 prime probably benign
IGL01872:Smg1 APN 7 118,148,944 (GRCm38) utr 3 prime probably benign
IGL02010:Smg1 APN 7 118,186,146 (GRCm38) utr 3 prime probably benign
IGL02158:Smg1 APN 7 118,212,946 (GRCm38) missense possibly damaging 0.77
IGL02268:Smg1 APN 7 118,182,541 (GRCm38) missense probably benign 0.19
IGL02314:Smg1 APN 7 118,154,709 (GRCm38) utr 3 prime probably benign
IGL02552:Smg1 APN 7 118,195,894 (GRCm38) utr 3 prime probably benign
IGL02577:Smg1 APN 7 118,203,122 (GRCm38) missense probably damaging 0.99
IGL02859:Smg1 APN 7 118,148,933 (GRCm38) utr 3 prime probably benign
IGL02890:Smg1 APN 7 118,185,501 (GRCm38) utr 3 prime probably benign
IGL02892:Smg1 APN 7 118,167,955 (GRCm38) utr 3 prime probably benign
IGL03119:Smg1 APN 7 118,195,113 (GRCm38) utr 3 prime probably benign
IGL03123:Smg1 APN 7 118,157,181 (GRCm38) utr 3 prime probably benign
IGL03128:Smg1 APN 7 118,203,059 (GRCm38) missense probably benign 0.03
IGL03184:Smg1 APN 7 118,180,380 (GRCm38) missense possibly damaging 0.86
PIT4508001:Smg1 UTSW 7 118,185,541 (GRCm38) missense unknown
R0010:Smg1 UTSW 7 118,171,859 (GRCm38) utr 3 prime probably benign
R0010:Smg1 UTSW 7 118,171,859 (GRCm38) utr 3 prime probably benign
R0025:Smg1 UTSW 7 118,212,443 (GRCm38) missense possibly damaging 0.92
R0025:Smg1 UTSW 7 118,212,443 (GRCm38) missense possibly damaging 0.92
R0098:Smg1 UTSW 7 118,145,467 (GRCm38) missense probably benign 0.02
R0139:Smg1 UTSW 7 118,152,675 (GRCm38) critical splice donor site probably null
R0371:Smg1 UTSW 7 118,168,300 (GRCm38) utr 3 prime probably benign
R0415:Smg1 UTSW 7 118,182,468 (GRCm38) missense probably benign 0.34
R0416:Smg1 UTSW 7 118,184,461 (GRCm38) splice site probably benign
R0423:Smg1 UTSW 7 118,176,880 (GRCm38) missense possibly damaging 0.53
R0600:Smg1 UTSW 7 118,160,383 (GRCm38) utr 3 prime probably benign
R0626:Smg1 UTSW 7 118,182,383 (GRCm38) missense possibly damaging 0.82
R0627:Smg1 UTSW 7 118,167,861 (GRCm38) utr 3 prime probably benign
R0727:Smg1 UTSW 7 118,166,422 (GRCm38) utr 3 prime probably benign
R0729:Smg1 UTSW 7 118,146,289 (GRCm38) utr 3 prime probably benign
R0841:Smg1 UTSW 7 118,143,301 (GRCm38) missense possibly damaging 0.96
R1114:Smg1 UTSW 7 118,159,790 (GRCm38) utr 3 prime probably benign
R1256:Smg1 UTSW 7 118,203,087 (GRCm38) missense probably damaging 1.00
R1298:Smg1 UTSW 7 118,168,211 (GRCm38) utr 3 prime probably benign
R1370:Smg1 UTSW 7 118,159,752 (GRCm38) utr 3 prime probably benign
R1591:Smg1 UTSW 7 118,156,919 (GRCm38) utr 3 prime probably benign
R1736:Smg1 UTSW 7 118,165,967 (GRCm38) splice site probably null
R1755:Smg1 UTSW 7 118,203,064 (GRCm38) nonsense probably null
R1765:Smg1 UTSW 7 118,139,715 (GRCm38) missense probably benign 0.03
R1789:Smg1 UTSW 7 118,145,798 (GRCm38) missense possibly damaging 0.73
R1845:Smg1 UTSW 7 118,154,622 (GRCm38) utr 3 prime probably benign
R1908:Smg1 UTSW 7 118,154,199 (GRCm38) utr 3 prime probably benign
R1909:Smg1 UTSW 7 118,154,199 (GRCm38) utr 3 prime probably benign
R1942:Smg1 UTSW 7 118,158,103 (GRCm38) utr 3 prime probably benign
R2064:Smg1 UTSW 7 118,156,867 (GRCm38) utr 3 prime probably benign
R2072:Smg1 UTSW 7 118,163,166 (GRCm38) utr 3 prime probably benign
R2154:Smg1 UTSW 7 118,158,076 (GRCm38) utr 3 prime probably benign
R2895:Smg1 UTSW 7 118,189,143 (GRCm38) utr 3 prime probably benign
R2915:Smg1 UTSW 7 118,210,879 (GRCm38) splice site probably benign
R3417:Smg1 UTSW 7 118,148,853 (GRCm38) utr 3 prime probably benign
R3873:Smg1 UTSW 7 118,154,662 (GRCm38) utr 3 prime probably benign
R4082:Smg1 UTSW 7 118,160,246 (GRCm38) utr 3 prime probably benign
R4230:Smg1 UTSW 7 118,148,733 (GRCm38) critical splice donor site probably null
R4304:Smg1 UTSW 7 118,139,518 (GRCm38) missense probably benign 0.03
R4549:Smg1 UTSW 7 118,159,683 (GRCm38) utr 3 prime probably benign
R4571:Smg1 UTSW 7 118,139,465 (GRCm38) missense possibly damaging 0.72
R4638:Smg1 UTSW 7 118,195,926 (GRCm38) utr 3 prime probably benign
R4642:Smg1 UTSW 7 118,154,264 (GRCm38) utr 3 prime probably benign
R4656:Smg1 UTSW 7 118,212,951 (GRCm38) missense probably benign 0.00
R4754:Smg1 UTSW 7 118,156,731 (GRCm38) utr 3 prime probably benign
R4798:Smg1 UTSW 7 118,180,474 (GRCm38) missense probably benign 0.32
R4906:Smg1 UTSW 7 118,152,408 (GRCm38) utr 3 prime probably benign
R4978:Smg1 UTSW 7 118,154,247 (GRCm38) utr 3 prime probably benign
R4989:Smg1 UTSW 7 118,208,051 (GRCm38) missense probably benign
R4989:Smg1 UTSW 7 118,158,100 (GRCm38) utr 3 prime probably benign
R5026:Smg1 UTSW 7 118,193,545 (GRCm38) utr 3 prime probably benign
R5124:Smg1 UTSW 7 118,213,012 (GRCm38) missense probably benign 0.00
R5318:Smg1 UTSW 7 118,160,204 (GRCm38) utr 3 prime probably benign
R5356:Smg1 UTSW 7 118,195,133 (GRCm38) utr 3 prime probably benign
R5404:Smg1 UTSW 7 118,206,908 (GRCm38) missense probably damaging 1.00
R5423:Smg1 UTSW 7 118,146,071 (GRCm38) missense possibly damaging 0.70
R5441:Smg1 UTSW 7 118,195,081 (GRCm38) utr 3 prime probably benign
R5490:Smg1 UTSW 7 118,139,436 (GRCm38) missense possibly damaging 0.86
R5541:Smg1 UTSW 7 118,157,163 (GRCm38) utr 3 prime probably benign
R5564:Smg1 UTSW 7 118,189,819 (GRCm38) utr 3 prime probably benign
R5580:Smg1 UTSW 7 118,148,902 (GRCm38) utr 3 prime probably benign
R5600:Smg1 UTSW 7 118,167,884 (GRCm38) utr 3 prime probably benign
R5628:Smg1 UTSW 7 118,154,701 (GRCm38) utr 3 prime probably benign
R5646:Smg1 UTSW 7 118,212,559 (GRCm38) missense probably benign 0.42
R5656:Smg1 UTSW 7 118,154,664 (GRCm38) utr 3 prime probably benign
R5660:Smg1 UTSW 7 118,143,347 (GRCm38) missense probably benign 0.33
R5706:Smg1 UTSW 7 118,145,590 (GRCm38) missense possibly damaging 0.86
R5786:Smg1 UTSW 7 118,212,897 (GRCm38) missense probably benign 0.12
R5890:Smg1 UTSW 7 118,190,586 (GRCm38) utr 3 prime probably benign
R5912:Smg1 UTSW 7 118,154,586 (GRCm38) utr 3 prime probably benign
R5977:Smg1 UTSW 7 118,141,357 (GRCm38) utr 3 prime probably benign
R5993:Smg1 UTSW 7 118,140,509 (GRCm38) missense probably benign 0.33
R6161:Smg1 UTSW 7 118,163,330 (GRCm38) utr 3 prime probably benign
R6187:Smg1 UTSW 7 118,189,163 (GRCm38) utr 3 prime probably benign
R6264:Smg1 UTSW 7 118,166,087 (GRCm38) utr 3 prime probably benign
R6331:Smg1 UTSW 7 118,154,277 (GRCm38) utr 3 prime probably benign
R6561:Smg1 UTSW 7 118,166,077 (GRCm38) utr 3 prime probably benign
R6571:Smg1 UTSW 7 118,184,514 (GRCm38) utr 3 prime probably benign
R6736:Smg1 UTSW 7 118,157,166 (GRCm38) utr 3 prime probably benign
R6752:Smg1 UTSW 7 118,163,316 (GRCm38) utr 3 prime probably benign
R6777:Smg1 UTSW 7 118,189,117 (GRCm38) utr 3 prime probably benign
R6788:Smg1 UTSW 7 118,184,571 (GRCm38) utr 3 prime probably benign
R6883:Smg1 UTSW 7 118,168,180 (GRCm38) utr 3 prime probably benign
R6991:Smg1 UTSW 7 118,167,868 (GRCm38) utr 3 prime probably benign
R7056:Smg1 UTSW 7 118,146,400 (GRCm38) splice site probably benign
R7058:Smg1 UTSW 7 118,198,279 (GRCm38) utr 3 prime probably benign
R7100:Smg1 UTSW 7 118,184,520 (GRCm38) missense unknown
R7133:Smg1 UTSW 7 118,152,908 (GRCm38) missense unknown
R7221:Smg1 UTSW 7 118,182,797 (GRCm38) missense possibly damaging 0.86
R7229:Smg1 UTSW 7 118,176,955 (GRCm38) missense probably benign 0.03
R7293:Smg1 UTSW 7 118,166,099 (GRCm38) missense unknown
R7361:Smg1 UTSW 7 118,184,977 (GRCm38) missense unknown
R7438:Smg1 UTSW 7 118,195,893 (GRCm38) missense unknown
R7686:Smg1 UTSW 7 118,167,858 (GRCm38) missense unknown
R7798:Smg1 UTSW 7 118,171,939 (GRCm38) missense possibly damaging 0.73
R7908:Smg1 UTSW 7 118,186,134 (GRCm38) missense unknown
R7923:Smg1 UTSW 7 118,143,322 (GRCm38) missense possibly damaging 0.96
R7978:Smg1 UTSW 7 118,193,655 (GRCm38) missense unknown
R7997:Smg1 UTSW 7 118,173,142 (GRCm38) missense unknown
R7997:Smg1 UTSW 7 118,173,141 (GRCm38) missense unknown
R8025:Smg1 UTSW 7 118,206,989 (GRCm38) nonsense probably null
R8056:Smg1 UTSW 7 118,160,366 (GRCm38) missense unknown
R8061:Smg1 UTSW 7 118,152,387 (GRCm38) missense unknown
R8095:Smg1 UTSW 7 118,173,062 (GRCm38) missense unknown
R8198:Smg1 UTSW 7 118,145,606 (GRCm38) missense probably benign 0.03
R8399:Smg1 UTSW 7 118,190,571 (GRCm38) missense unknown
R8445:Smg1 UTSW 7 118,136,977 (GRCm38) missense possibly damaging 0.72
R8519:Smg1 UTSW 7 118,171,759 (GRCm38) utr 3 prime probably benign
R8817:Smg1 UTSW 7 118,159,664 (GRCm38) missense unknown
R8832:Smg1 UTSW 7 118,139,783 (GRCm38) missense probably benign 0.33
R8855:Smg1 UTSW 7 118,206,899 (GRCm38) missense unknown
R8866:Smg1 UTSW 7 118,206,899 (GRCm38) missense unknown
R8946:Smg1 UTSW 7 118,152,677 (GRCm38) missense probably null
R8954:Smg1 UTSW 7 118,206,992 (GRCm38) missense probably damaging 1.00
R8967:Smg1 UTSW 7 118,166,516 (GRCm38) missense unknown
R9072:Smg1 UTSW 7 118,183,809 (GRCm38) missense unknown
R9090:Smg1 UTSW 7 118,212,563 (GRCm38) missense unknown
R9156:Smg1 UTSW 7 118,154,661 (GRCm38) missense unknown
R9198:Smg1 UTSW 7 118,195,956 (GRCm38) missense unknown
R9240:Smg1 UTSW 7 118,139,808 (GRCm38) missense probably benign 0.18
R9271:Smg1 UTSW 7 118,212,563 (GRCm38) missense unknown
R9289:Smg1 UTSW 7 118,145,416 (GRCm38) missense possibly damaging 0.53
R9378:Smg1 UTSW 7 118,178,775 (GRCm38) nonsense probably null
R9396:Smg1 UTSW 7 118,208,080 (GRCm38) missense unknown
R9469:Smg1 UTSW 7 118,140,551 (GRCm38) missense possibly damaging 0.72
R9539:Smg1 UTSW 7 118,145,753 (GRCm38) missense probably benign 0.03
R9549:Smg1 UTSW 7 118,196,031 (GRCm38) missense unknown
R9563:Smg1 UTSW 7 118,212,985 (GRCm38) missense unknown
R9564:Smg1 UTSW 7 118,212,985 (GRCm38) missense unknown
R9597:Smg1 UTSW 7 118,213,047 (GRCm38) missense unknown
R9643:Smg1 UTSW 7 118,156,710 (GRCm38) missense unknown
R9703:Smg1 UTSW 7 118,140,521 (GRCm38) missense possibly damaging 0.73
R9730:Smg1 UTSW 7 118,183,781 (GRCm38) missense unknown
Z1088:Smg1 UTSW 7 118,178,399 (GRCm38) missense possibly damaging 0.96
Z1088:Smg1 UTSW 7 118,168,661 (GRCm38) nonsense probably null
Z1088:Smg1 UTSW 7 118,154,635 (GRCm38) utr 3 prime probably benign
Z1176:Smg1 UTSW 7 118,206,907 (GRCm38) missense unknown
Z1176:Smg1 UTSW 7 118,206,887 (GRCm38) missense unknown
Z1177:Smg1 UTSW 7 118,213,033 (GRCm38) missense unknown
Z1177:Smg1 UTSW 7 118,168,608 (GRCm38) missense probably null
Predicted Primers PCR Primer
(F):5'- CCTTAGTCTCCAAAGCCCTG -3'
(R):5'- TCAGTTCTGGGACTGCATTATG -3'

Sequencing Primer
(F):5'- CAGGCATGTGTCACTATTGC -3'
(R):5'- CAGTTCTGGGACTGCATTATGAAATG -3'
Posted On 2015-02-18