Incidental Mutation 'R3416:Cyb561d2'
ID266806
Institutional Source Beutler Lab
Gene Symbol Cyb561d2
Ensembl Gene ENSMUSG00000037190
Gene Namecytochrome b-561 domain containing 2
SynonymsTsp10, 101F6 protein
MMRRC Submission 040634-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3416 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107539007-107542193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107540126 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 142 (L142P)
Ref Sequence ENSEMBL: ENSMUSP00000141723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010189] [ENSMUST00000010201] [ENSMUST00000041459] [ENSMUST00000194967] [ENSMUST00000195235] [ENSMUST00000195370]
Predicted Effect probably benign
Transcript: ENSMUST00000010189
SMART Domains Protein: ENSMUSP00000010189
Gene: ENSMUSG00000010045

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
DUF1751 49 151 4.14e-41 SMART
transmembrane domain 164 183 N/A INTRINSIC
transmembrane domain 190 208 N/A INTRINSIC
transmembrane domain 223 245 N/A INTRINSIC
Blast:DUF1751 304 347 2e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000010201
SMART Domains Protein: ENSMUSP00000010201
Gene: ENSMUSG00000010057

DomainStartEndE-ValueType
Pfam:NPR2 5 279 1.7e-75 PFAM
Pfam:NPR2 269 373 1.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000041459
AA Change: L142P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044093
Gene: ENSMUSG00000037190
AA Change: L142P

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
B561 47 178 8.01e-42 SMART
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193628
Predicted Effect probably benign
Transcript: ENSMUST00000194344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194906
Predicted Effect probably benign
Transcript: ENSMUST00000194967
Predicted Effect probably damaging
Transcript: ENSMUST00000195235
AA Change: L142P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141723
Gene: ENSMUSG00000037190
AA Change: L142P

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
B561 47 178 8.01e-42 SMART
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195370
SMART Domains Protein: ENSMUSP00000141746
Gene: ENSMUSG00000010057

DomainStartEndE-ValueType
Pfam:NPR2 2 156 1.2e-52 PFAM
Meta Mutation Damage Score 0.9534 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik T C 10: 83,759,632 probably null Het
Abi1 T C 2: 23,040,002 S22G probably damaging Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Adnp2 T C 18: 80,128,158 E1012G possibly damaging Het
Azin1 A T 15: 38,493,546 S278T possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyhr1 A T 15: 76,658,715 probably null Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Fryl T C 5: 73,108,074 Q510R possibly damaging Het
Gfra1 T C 19: 58,267,112 Y301C probably damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mycs C T X: 5,468,756 S90N possibly damaging Het
Olfr508 G A 7: 108,630,018 V9I possibly damaging Het
Pcdha8 A T 18: 36,992,630 Q55L probably benign Het
Pkhd1l1 A G 15: 44,547,364 T2756A probably damaging Het
Prl8a8 A T 13: 27,511,549 C71S probably damaging Het
Ralgapa1 T A 12: 55,770,613 probably benign Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn4a A T 11: 106,330,413 S807T probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Smg1 G C 7: 118,148,853 probably benign Het
Spata1 A T 3: 146,487,508 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Susd5 A G 9: 114,095,658 D203G possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tha1 T C 11: 117,873,200 D67G possibly damaging Het
Vmn2r120 T A 17: 57,509,241 I705F possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zan T A 5: 137,435,720 E2250D unknown Het
Zfp560 A T 9: 20,347,678 Y629* probably null Het
Other mutations in Cyb561d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Cyb561d2 APN 9 107540289 critical splice donor site probably null
IGL01890:Cyb561d2 APN 9 107541523 missense probably damaging 0.98
IGL02668:Cyb561d2 APN 9 107540172 missense probably benign 0.00
R1434:Cyb561d2 UTSW 9 107541643 unclassified probably benign
R1937:Cyb561d2 UTSW 9 107540316 missense probably damaging 1.00
R4995:Cyb561d2 UTSW 9 107541548 missense probably damaging 1.00
R6538:Cyb561d2 UTSW 9 107540017 missense possibly damaging 0.86
R7564:Cyb561d2 UTSW 9 107541019 missense probably benign 0.02
R7719:Cyb561d2 UTSW 9 107540184 missense probably benign
R8117:Cyb561d2 UTSW 9 107541572 missense probably benign 0.43
Z1176:Cyb561d2 UTSW 9 107540296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGGCATTGCTCACTTGGTTC -3'
(R):5'- TCTCCTTCCTGATGACCGAG -3'

Sequencing Primer
(F):5'- GCATTGCTCACTTGGTTCATGATTAC -3'
(R):5'- TGAGAGTTCCCTGCTGCG -3'
Posted On2015-02-18