Incidental Mutation 'R3416:1500009L16Rik'
List |< first << previous [record 58 of 86095] next >> last >|
ID266808
Institutional Source Beutler Lab
Gene Symbol 1500009L16Rik
Ensembl Gene ENSMUSG00000087651
Gene NameRIKEN cDNA 1500009L16 gene
Synonyms
MMRRC Submission 040634-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3416 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location83722865-83762762 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 83759632 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000150459]
Predicted Effect probably null
Transcript: ENSMUST00000150459
SMART Domains Protein: ENSMUSP00000129542
Gene: ENSMUSG00000087651

DomainStartEndE-ValueType
Pfam:OCC1 1 62 4.3e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000218623
Meta Mutation Damage Score 0.494 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 23,040,002 S22G probably damaging Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Adnp2 T C 18: 80,128,158 E1012G possibly damaging Het
Azin1 A T 15: 38,493,546 S278T possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyb561d2 A G 9: 107,540,126 L142P probably damaging Het
Cyhr1 A T 15: 76,658,715 probably null Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Fryl T C 5: 73,108,074 Q510R possibly damaging Het
Gfra1 T C 19: 58,267,112 Y301C probably damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mycs C T X: 5,468,756 S90N possibly damaging Het
Olfr508 G A 7: 108,630,018 V9I possibly damaging Het
Pcdha8 A T 18: 36,992,630 Q55L probably benign Het
Pkhd1l1 A G 15: 44,547,364 T2756A probably damaging Het
Prl8a8 A T 13: 27,511,549 C71S probably damaging Het
Ralgapa1 T A 12: 55,770,613 probably benign Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn4a A T 11: 106,330,413 S807T probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Smg1 G C 7: 118,148,853 probably benign Het
Spata1 A T 3: 146,487,508 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Susd5 A G 9: 114,095,658 D203G possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tha1 T C 11: 117,873,200 D67G possibly damaging Het
Vmn2r120 T A 17: 57,509,241 I705F possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zan T A 5: 137,435,720 E2250D unknown Het
Zfp560 A T 9: 20,347,678 Y629* probably null Het
Other mutations in 1500009L16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0483:1500009L16Rik UTSW 10 83759638 splice site probably benign
R4307:1500009L16Rik UTSW 10 83737928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGATGCATCTTGCCCAC -3'
(R):5'- AGGTCTCCATCAAGCCCTAAG -3'

Sequencing Primer
(F):5'- CTTTATGATTCCTGCTAGCAAGTG -3'
(R):5'- AAGCCCTCCCAGGTTTTGGTG -3'
Posted On2015-02-18