Incidental Mutation 'R3416:Prl8a8'
ID266812
Institutional Source Beutler Lab
Gene Symbol Prl8a8
Ensembl Gene ENSMUSG00000021346
Gene Nameprolactin family 8, subfamily a, member 81
Synonyms1600032B14Rik, PLP-Cgamma, Prlpc3
MMRRC Submission 040634-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3416 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location27506968-27513217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27511549 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 71 (C71S)
Ref Sequence ENSEMBL: ENSMUSP00000153131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018389] [ENSMUST00000110350] [ENSMUST00000223621] [ENSMUST00000224072]
Predicted Effect probably damaging
Transcript: ENSMUST00000018389
AA Change: C33S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018389
Gene: ENSMUSG00000021346
AA Change: C33S

DomainStartEndE-ValueType
Pfam:Hormone_1 16 240 2.8e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110350
AA Change: C34S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105979
Gene: ENSMUSG00000021346
AA Change: C34S

DomainStartEndE-ValueType
Pfam:Hormone_1 17 241 3.1e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223621
AA Change: C72S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224072
AA Change: C71S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik T C 10: 83,759,632 probably null Het
Abi1 T C 2: 23,040,002 S22G probably damaging Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Adnp2 T C 18: 80,128,158 E1012G possibly damaging Het
Azin1 A T 15: 38,493,546 S278T possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyb561d2 A G 9: 107,540,126 L142P probably damaging Het
Cyhr1 A T 15: 76,658,715 probably null Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Fryl T C 5: 73,108,074 Q510R possibly damaging Het
Gfra1 T C 19: 58,267,112 Y301C probably damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mycs C T X: 5,468,756 S90N possibly damaging Het
Olfr508 G A 7: 108,630,018 V9I possibly damaging Het
Pcdha8 A T 18: 36,992,630 Q55L probably benign Het
Pkhd1l1 A G 15: 44,547,364 T2756A probably damaging Het
Ralgapa1 T A 12: 55,770,613 probably benign Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn4a A T 11: 106,330,413 S807T probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Smg1 G C 7: 118,148,853 probably benign Het
Spata1 A T 3: 146,487,508 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Susd5 A G 9: 114,095,658 D203G possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tha1 T C 11: 117,873,200 D67G possibly damaging Het
Vmn2r120 T A 17: 57,509,241 I705F possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zan T A 5: 137,435,720 E2250D unknown Het
Zfp560 A T 9: 20,347,678 Y629* probably null Het
Other mutations in Prl8a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Prl8a8 APN 13 27509610 missense probably damaging 0.96
R0117:Prl8a8 UTSW 13 27508490 missense probably damaging 1.00
R0515:Prl8a8 UTSW 13 27508367 missense probably damaging 0.99
R0602:Prl8a8 UTSW 13 27508550 splice site probably benign
R0708:Prl8a8 UTSW 13 27511545 missense possibly damaging 0.64
R1824:Prl8a8 UTSW 13 27508450 missense probably damaging 1.00
R4432:Prl8a8 UTSW 13 27510480 missense probably benign 0.41
R6107:Prl8a8 UTSW 13 27511464 missense possibly damaging 0.70
R6146:Prl8a8 UTSW 13 27510480 missense probably damaging 1.00
R6398:Prl8a8 UTSW 13 27508429 missense probably damaging 1.00
R6493:Prl8a8 UTSW 13 27507352 nonsense probably null
R7069:Prl8a8 UTSW 13 27511467 missense probably benign 0.30
R7104:Prl8a8 UTSW 13 27511496 missense probably damaging 1.00
R7493:Prl8a8 UTSW 13 27511435 splice site probably null
R8147:Prl8a8 UTSW 13 27511581 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTCAGGATGTTTAGAGTCTCAGG -3'
(R):5'- CAGTGCTTAGAGTGACTTGATATG -3'

Sequencing Primer
(F):5'- AGAGTCTCAGGTTCTAGTGCAG -3'
(R):5'- GCTTAGAGTGACTTGATATGTCATTC -3'
Posted On2015-02-18