Incidental Mutation 'R3416:Azin1'
ID 266814
Institutional Source Beutler Lab
Gene Symbol Azin1
Ensembl Gene ENSMUSG00000037458
Gene Name antizyme inhibitor 1
Synonyms Oazin, 1700085L02Rik, ODC antizyme inhibitor, Oazi
MMRRC Submission 040634-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3416 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 38487671-38519510 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 38493790 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 278 (S278T)
Ref Sequence ENSEMBL: ENSMUSP00000105958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065308] [ENSMUST00000110329] [ENSMUST00000129589]
AlphaFold O35484
Predicted Effect possibly damaging
Transcript: ENSMUST00000065308
AA Change: S278T

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065544
Gene: ENSMUSG00000037458
AA Change: S278T

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 5.2e-66 PFAM
Pfam:Orn_DAP_Arg_deC 282 406 1.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110328
SMART Domains Protein: ENSMUSP00000105957
Gene: ENSMUSG00000037458

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 9.4e-67 PFAM
Pfam:Orn_DAP_Arg_deC 282 357 7.4e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110329
AA Change: S278T

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105958
Gene: ENSMUSG00000037458
AA Change: S278T

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 5.4e-69 PFAM
Pfam:Orn_DAP_Arg_deC 283 405 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129589
SMART Domains Protein: ENSMUSP00000117988
Gene: ENSMUSG00000037458

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 154 1.8e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226152
Meta Mutation Damage Score 0.1240 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 1, the first member of this gene family that is ubiquitously expressed, and is localized in the nucleus and cytoplasm. Overexpression of antizyme inhibitor 1 gene has been associated with increased proliferation, cellular transformation and tumorigenesis. Gene knockout studies showed that homozygous mutant mice lacking functional antizyme inhibitor 1 gene died at birth with abnormal liver morphology. RNA editing of this gene, predominantly in the liver tissue, has been linked to the progression of hepatocellular carcinoma. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous disruption of this gene results in neonatal lethality, a slight reduction in birth weight, and abnormal liver morphology. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik T C 10: 83,595,496 (GRCm39) probably null Het
Abi1 T C 2: 22,930,014 (GRCm39) S22G probably damaging Het
Adgrl2 T C 3: 148,564,965 (GRCm39) Y201C probably damaging Het
Adnp2 T C 18: 80,171,373 (GRCm39) E1012G possibly damaging Het
Crocc G A 4: 140,773,758 (GRCm39) T103I possibly damaging Het
Cyb561d2 A G 9: 107,417,325 (GRCm39) L142P probably damaging Het
Cyp4f39 T C 17: 32,708,716 (GRCm39) V421A possibly damaging Het
Fryl T C 5: 73,265,417 (GRCm39) Q510R possibly damaging Het
Gfra1 T C 19: 58,255,544 (GRCm39) Y301C probably damaging Het
Igsf9b G A 9: 27,220,774 (GRCm39) V47I possibly damaging Het
Klhl42 G A 6: 147,009,378 (GRCm39) V406M probably damaging Het
Mfsd13a C T 19: 46,360,431 (GRCm39) R328C probably damaging Het
Mycs C T X: 5,380,810 (GRCm39) S90N possibly damaging Het
Or5p80 G A 7: 108,229,225 (GRCm39) V9I possibly damaging Het
Pcdha8 A T 18: 37,125,683 (GRCm39) Q55L probably benign Het
Pkhd1l1 A G 15: 44,410,760 (GRCm39) T2756A probably damaging Het
Prl8a8 A T 13: 27,695,532 (GRCm39) C71S probably damaging Het
Ralgapa1 T A 12: 55,817,398 (GRCm39) probably benign Het
Rtl4 C T X: 143,902,901 (GRCm39) Q108* probably null Het
Scn4a A T 11: 106,221,239 (GRCm39) S807T probably benign Het
Sla2 G A 2: 156,717,862 (GRCm39) R137C probably damaging Het
Smg1 G C 7: 117,748,076 (GRCm39) probably benign Het
Spata1 A T 3: 146,193,263 (GRCm39) probably benign Het
Strbp C G 2: 37,480,737 (GRCm39) R610T possibly damaging Het
Susd5 A G 9: 113,924,726 (GRCm39) D203G possibly damaging Het
Tas2r124 A T 6: 132,732,601 (GRCm39) R303S probably benign Het
Tgm3 G A 2: 129,889,692 (GRCm39) V629M possibly damaging Het
Tha1 T C 11: 117,764,026 (GRCm39) D67G possibly damaging Het
Vmn2r120 T A 17: 57,816,241 (GRCm39) I705F possibly damaging Het
Vrk3 C T 7: 44,424,866 (GRCm39) T427M probably benign Het
Zan T A 5: 137,433,982 (GRCm39) E2250D unknown Het
Zfp560 A T 9: 20,258,974 (GRCm39) Y629* probably null Het
Zftraf1 A T 15: 76,542,915 (GRCm39) probably null Het
Other mutations in Azin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02174:Azin1 APN 15 38,493,730 (GRCm39) missense probably benign
IGL02406:Azin1 APN 15 38,491,809 (GRCm39) missense probably benign 0.00
H2330:Azin1 UTSW 15 38,497,520 (GRCm39) missense probably damaging 0.98
R0562:Azin1 UTSW 15 38,493,825 (GRCm39) missense probably benign 0.00
R3434:Azin1 UTSW 15 38,493,820 (GRCm39) missense probably benign 0.00
R3978:Azin1 UTSW 15 38,498,957 (GRCm39) missense probably damaging 0.99
R4535:Azin1 UTSW 15 38,493,849 (GRCm39) missense probably benign 0.11
R4720:Azin1 UTSW 15 38,493,744 (GRCm39) missense probably benign 0.43
R5266:Azin1 UTSW 15 38,491,795 (GRCm39) missense probably benign
R6416:Azin1 UTSW 15 38,492,587 (GRCm39) missense possibly damaging 0.71
R7242:Azin1 UTSW 15 38,501,749 (GRCm39) start codon destroyed probably null 1.00
R7283:Azin1 UTSW 15 38,501,652 (GRCm39) missense probably damaging 0.98
R7577:Azin1 UTSW 15 38,501,665 (GRCm39) missense probably benign 0.01
R7604:Azin1 UTSW 15 38,491,878 (GRCm39) missense probably damaging 1.00
R8221:Azin1 UTSW 15 38,492,572 (GRCm39) missense probably damaging 1.00
R8683:Azin1 UTSW 15 38,493,775 (GRCm39) missense probably damaging 1.00
R9229:Azin1 UTSW 15 38,490,646 (GRCm39) missense probably benign
R9420:Azin1 UTSW 15 38,493,871 (GRCm39) missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GTCTGACGCTCTAGTAAAGTAAGAG -3'
(R):5'- TCCCTGCTAGGTTGGAATTG -3'

Sequencing Primer
(F):5'- GTAGATTCTCCATCCAATACAAGAGG -3'
(R):5'- CCCTGCTAGGTTGGAATTGAATAG -3'
Posted On 2015-02-18