Incidental Mutation 'R3416:Azin1'
ID266814
Institutional Source Beutler Lab
Gene Symbol Azin1
Ensembl Gene ENSMUSG00000037458
Gene Nameantizyme inhibitor 1
SynonymsODC antizyme inhibitor, Oazi, Oazin, 1700085L02Rik
MMRRC Submission 040634-MU
Accession Numbers

Genbank: NM_018745; MGI: 1859169

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3416 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location38487427-38519266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38493546 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 278 (S278T)
Ref Sequence ENSEMBL: ENSMUSP00000105958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065308] [ENSMUST00000110329] [ENSMUST00000129589]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065308
AA Change: S278T

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065544
Gene: ENSMUSG00000037458
AA Change: S278T

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 5.2e-66 PFAM
Pfam:Orn_DAP_Arg_deC 282 406 1.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110328
SMART Domains Protein: ENSMUSP00000105957
Gene: ENSMUSG00000037458

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 9.4e-67 PFAM
Pfam:Orn_DAP_Arg_deC 282 357 7.4e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110329
AA Change: S278T

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105958
Gene: ENSMUSG00000037458
AA Change: S278T

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 5.4e-69 PFAM
Pfam:Orn_DAP_Arg_deC 283 405 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129589
SMART Domains Protein: ENSMUSP00000117988
Gene: ENSMUSG00000037458

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 154 1.8e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226152
Meta Mutation Damage Score 0.1240 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 1, the first member of this gene family that is ubiquitously expressed, and is localized in the nucleus and cytoplasm. Overexpression of antizyme inhibitor 1 gene has been associated with increased proliferation, cellular transformation and tumorigenesis. Gene knockout studies showed that homozygous mutant mice lacking functional antizyme inhibitor 1 gene died at birth with abnormal liver morphology. RNA editing of this gene, predominantly in the liver tissue, has been linked to the progression of hepatocellular carcinoma. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous disruption of this gene results in neonatal lethality, a slight reduction in birth weight, and abnormal liver morphology. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik T C 10: 83,759,632 probably null Het
Abi1 T C 2: 23,040,002 S22G probably damaging Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Adnp2 T C 18: 80,128,158 E1012G possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyb561d2 A G 9: 107,540,126 L142P probably damaging Het
Cyhr1 A T 15: 76,658,715 probably null Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Fryl T C 5: 73,108,074 Q510R possibly damaging Het
Gfra1 T C 19: 58,267,112 Y301C probably damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mycs C T X: 5,468,756 S90N possibly damaging Het
Olfr508 G A 7: 108,630,018 V9I possibly damaging Het
Pcdha8 A T 18: 36,992,630 Q55L probably benign Het
Pkhd1l1 A G 15: 44,547,364 T2756A probably damaging Het
Prl8a8 A T 13: 27,511,549 C71S probably damaging Het
Ralgapa1 T A 12: 55,770,613 probably benign Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn4a A T 11: 106,330,413 S807T probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Smg1 G C 7: 118,148,853 probably benign Het
Spata1 A T 3: 146,487,508 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Susd5 A G 9: 114,095,658 D203G possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tha1 T C 11: 117,873,200 D67G possibly damaging Het
Vmn2r120 T A 17: 57,509,241 I705F possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zan T A 5: 137,435,720 E2250D unknown Het
Zfp560 A T 9: 20,347,678 Y629* probably null Het
Other mutations in Azin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02174:Azin1 APN 15 38493486 missense probably benign
IGL02406:Azin1 APN 15 38491565 missense probably benign 0.00
H2330:Azin1 UTSW 15 38497276 missense probably damaging 0.98
R0562:Azin1 UTSW 15 38493581 missense probably benign 0.00
R3434:Azin1 UTSW 15 38493576 missense probably benign 0.00
R3978:Azin1 UTSW 15 38498713 missense probably damaging 0.99
R4535:Azin1 UTSW 15 38493605 missense probably benign 0.11
R4720:Azin1 UTSW 15 38493500 missense probably benign 0.43
R5266:Azin1 UTSW 15 38491551 missense probably benign
R6416:Azin1 UTSW 15 38492343 missense possibly damaging 0.71
R7242:Azin1 UTSW 15 38501505 start codon destroyed probably null 1.00
R7283:Azin1 UTSW 15 38501408 missense probably damaging 0.98
R7577:Azin1 UTSW 15 38501421 missense probably benign 0.01
R7604:Azin1 UTSW 15 38491634 missense probably damaging 1.00
R8221:Azin1 UTSW 15 38492328 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGACGCTCTAGTAAAGTAAGAG -3'
(R):5'- TCCCTGCTAGGTTGGAATTG -3'

Sequencing Primer
(F):5'- GTAGATTCTCCATCCAATACAAGAGG -3'
(R):5'- CCCTGCTAGGTTGGAATTGAATAG -3'
Posted On2015-02-18