Incidental Mutation 'R3416:Gfra1'
ID266821
Institutional Source Beutler Lab
Gene Symbol Gfra1
Ensembl Gene ENSMUSG00000025089
Gene Nameglial cell line derived neurotrophic factor family receptor alpha 1
SynonymsGDNFR-alpha, GFR alpha-1
MMRRC Submission 040634-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3416 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location58235604-58455909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58267112 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 301 (Y301C)
Ref Sequence ENSEMBL: ENSMUSP00000130128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026076] [ENSMUST00000129100] [ENSMUST00000140141] [ENSMUST00000152507] [ENSMUST00000169850]
Predicted Effect probably damaging
Transcript: ENSMUST00000026076
AA Change: Y301C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026076
Gene: ENSMUSG00000025089
AA Change: Y301C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129100
AA Change: Y296C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117196
Gene: ENSMUSG00000025089
AA Change: Y296C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 149 228 6.55e-24 SMART
GDNF 238 332 1.62e-28 SMART
low complexity region 357 365 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140141
AA Change: Y301C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123022
Gene: ENSMUSG00000025089
AA Change: Y301C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152507
AA Change: Y301C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120333
Gene: ENSMUSG00000025089
AA Change: Y301C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169850
AA Change: Y301C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130128
Gene: ENSMUSG00000025089
AA Change: Y301C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Meta Mutation Damage Score 0.9536 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that functions as the receptor for glial cell line derived neurotrophic factor (GDNF). The encoded protein undergoes proteolytic processing to generate a glycosylphosphatidylinositol-anchored cell surface coreceptor that forms a complex with the Ret tyrosine kinase in GDNF signaling pathway. Mice lacking the encoded protein exhibit deficits in the kidneys, the enteric nervous system, and spinal motor and sensory neurons similar mice deficient in GDNF or Ret. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations lack kidneys and enteric neurons resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik T C 10: 83,759,632 probably null Het
Abi1 T C 2: 23,040,002 S22G probably damaging Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Adnp2 T C 18: 80,128,158 E1012G possibly damaging Het
Azin1 A T 15: 38,493,546 S278T possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyb561d2 A G 9: 107,540,126 L142P probably damaging Het
Cyhr1 A T 15: 76,658,715 probably null Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Fryl T C 5: 73,108,074 Q510R possibly damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mycs C T X: 5,468,756 S90N possibly damaging Het
Olfr508 G A 7: 108,630,018 V9I possibly damaging Het
Pcdha8 A T 18: 36,992,630 Q55L probably benign Het
Pkhd1l1 A G 15: 44,547,364 T2756A probably damaging Het
Prl8a8 A T 13: 27,511,549 C71S probably damaging Het
Ralgapa1 T A 12: 55,770,613 probably benign Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn4a A T 11: 106,330,413 S807T probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Smg1 G C 7: 118,148,853 probably benign Het
Spata1 A T 3: 146,487,508 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Susd5 A G 9: 114,095,658 D203G possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tha1 T C 11: 117,873,200 D67G possibly damaging Het
Vmn2r120 T A 17: 57,509,241 I705F possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zan T A 5: 137,435,720 E2250D unknown Het
Zfp560 A T 9: 20,347,678 Y629* probably null Het
Other mutations in Gfra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Gfra1 APN 19 58263905 splice site probably benign
IGL01633:Gfra1 APN 19 58267047 missense probably benign 0.41
IGL02675:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02676:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02677:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02723:Gfra1 APN 19 58453251 missense probably benign 0.00
3-1:Gfra1 UTSW 19 58298567 intron probably benign
R0245:Gfra1 UTSW 19 58300554 missense possibly damaging 0.72
R0652:Gfra1 UTSW 19 58300554 missense possibly damaging 0.72
R0697:Gfra1 UTSW 19 58270123 missense probably benign
R0699:Gfra1 UTSW 19 58270123 missense probably benign
R1344:Gfra1 UTSW 19 58238417 missense possibly damaging 0.88
R1418:Gfra1 UTSW 19 58238417 missense possibly damaging 0.88
R1468:Gfra1 UTSW 19 58451975 missense probably benign 0.00
R1468:Gfra1 UTSW 19 58451975 missense probably benign 0.00
R2001:Gfra1 UTSW 19 58300275 missense probably damaging 1.00
R2866:Gfra1 UTSW 19 58239307 missense possibly damaging 0.93
R4352:Gfra1 UTSW 19 58267024 missense probably benign 0.08
R4564:Gfra1 UTSW 19 58239250 splice site probably null
R4727:Gfra1 UTSW 19 58263954 missense probably damaging 0.96
R4755:Gfra1 UTSW 19 58453244 missense probably damaging 1.00
R4914:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R4915:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R4917:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R5813:Gfra1 UTSW 19 58239255 missense probably benign
R6225:Gfra1 UTSW 19 58238398 missense probably damaging 1.00
R7023:Gfra1 UTSW 19 58454332 missense probably damaging 1.00
R7485:Gfra1 UTSW 19 58300312 missense probably damaging 1.00
R7624:Gfra1 UTSW 19 58238446 missense probably benign
R7718:Gfra1 UTSW 19 58453457 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GCAGACAGACAGAACTTCCG -3'
(R):5'- GCTCAAGATAAATTGCCAAGAAACG -3'

Sequencing Primer
(F):5'- AGAACTTCCGCTCAAAGAGG -3'
(R):5'- GCACCGCTTAACATAATTCCCTG -3'
Posted On2015-02-18