Mutagenetix > Incidental Mutations

Incidental Mutation 'R3417:Ankar'

266825

Institutional Source

Beutler Lab

Gene Symbol

Ankar

Ensembl Gene

ENSMUSG00000039342

Gene Name

ankyrin and armadillo repeat containing

Synonyms

4932422E22Rik

MMRRC Submission

040635-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R3417 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72642980-72700579 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 72658976 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148640 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]

AlphaFold

A2RT91

Predicted Effect

probably null
Transcript: ENSMUST00000053499

SMART Domains

Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342

Domain	Start	End	E-Value	Type
low complexity region	46	51	N/A	INTRINSIC
low complexity region	484	496	N/A	INTRINSIC
ANK	532	561	1.25e2	SMART
ANK	582	611	3.49e0	SMART
ANK	615	644	4.44e2	SMART
ANK	651	680	3.8e-1	SMART
ANK	684	714	9.87e0	SMART
ARM	744	784	5.96e-3	SMART
ARM	785	825	4.09e0	SMART
Blast:ARM	827	865	1e-15	BLAST
ARM	867	907	8.34e0	SMART
ARM	909	949	8.34e0	SMART
Blast:ARM	951	991	2e-13	BLAST
ARM	1034	1077	4.82e1	SMART
ARM	1084	1123	1.3e1	SMART
ARM	1257	1297	6.01e0	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000211837

Predicted Effect

probably null
Transcript: ENSMUST00000212573

Meta Mutation Damage Score

0.9484

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

98% (54/55)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	A	C	16: 38,828,740	D2E	probably benign	Het
Abcc5	A	G	16: 20,405,552		probably benign	Het
Adgrl2	T	C	3: 148,859,329	Y201C	probably damaging	Het
Ankrd17	G	A	5: 90,243,913	T1857I	possibly damaging	Het
Atp6v0d2	A	G	4: 19,888,829		probably benign	Het
Cep170	G	T	1: 176,756,044	P923Q	probably damaging	Het
Cfc1	A	T	1: 34,536,376	R44*	probably null	Het
Col6a1	C	T	10: 76,712,369	V618M	unknown	Het
Crmp1	A	T	5: 37,268,687	I159L	possibly damaging	Het
Crocc	G	A	4: 141,046,447	T103I	possibly damaging	Het
Cyp4f39	T	C	17: 32,489,742	V421A	possibly damaging	Het
Ero1l	T	C	14: 45,287,866	T401A	possibly damaging	Het
Exoc6b	C	G	6: 84,890,565	L288F	possibly damaging	Het
Fsip2	G	A	2: 82,986,510	V4196I	possibly damaging	Het
Gm884	A	T	11: 103,614,609	S2178T	possibly damaging	Het
Icosl	A	T	10: 78,072,035	N143I	possibly damaging	Het
Igsf9b	G	A	9: 27,309,478	V47I	possibly damaging	Het
Jrk	A	G	15: 74,706,885	Y184H	probably damaging	Het
Kdm5b	T	C	1: 134,587,977	L113P	probably damaging	Het
Klhl42	G	A	6: 147,107,880	V406M	probably damaging	Het
Lrp12	A	G	15: 39,878,282	F365L	probably damaging	Het
Map4k5	A	T	12: 69,809,264	V716E	probably damaging	Het
Mcm9	T	C	10: 53,537,407	T1264A	possibly damaging	Het
Mia3	T	A	1: 183,362,100	D100V	probably damaging	Het
Mrgprb2	C	A	7: 48,552,533	R148L	probably damaging	Het
Mrvi1	T	C	7: 110,876,954	T597A	possibly damaging	Het
Mterf1a	A	G	5: 3,890,795	S358P	probably damaging	Het
Myd88	T	C	9: 119,337,490	I253V	possibly damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nqo2	G	T	13: 33,979,633	V92L	probably benign	Het
Olfr730	T	A	14: 50,186,612	T202S	possibly damaging	Het
Pcdhb15	A	T	18: 37,475,163	N483Y	probably damaging	Het
Pds5a	A	G	5: 65,637,892	F667S	probably damaging	Het
Plxnb1	C	A	9: 109,100,760	A228E	probably damaging	Het
Prpsap1	T	C	11: 116,478,584	S179G	probably benign	Het
Rtl4	C	T	X: 145,119,905	Q108*	probably null	Het
Scn8a	A	G	15: 100,971,668		probably benign	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Slc44a1	G	A	4: 53,553,549	V519I	probably benign	Het
Smg1	G	C	7: 118,148,853		probably benign	Het
Sptlc2	A	G	12: 87,346,808		probably benign	Het
St13	A	T	15: 81,369,450		probably benign	Het
Strbp	C	G	2: 37,590,725	R610T	possibly damaging	Het
Tas2r124	A	T	6: 132,755,638	R303S	probably benign	Het
Tgm3	G	A	2: 130,047,772	V629M	possibly damaging	Het
Tnr	T	C	1: 159,895,042	V1019A	probably benign	Het
Ttn	A	T	2: 76,785,564	C14932*	probably null	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het

Other mutations in Ankar

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00338:Ankar	APN	1	72690131	missense	probably damaging	1.00
IGL01013:Ankar	APN	1	72650989	missense	possibly damaging	0.90
IGL01135:Ankar	APN	1	72665219	missense	probably benign	0.28
IGL01824:Ankar	APN	1	72651727	missense	probably benign	0.40
IGL01885:Ankar	APN	1	72658703	missense	probably damaging	1.00
IGL01932:Ankar	APN	1	72698987	missense	probably benign	0.25
IGL02143:Ankar	APN	1	72658649	critical splice donor site	probably null
IGL02326:Ankar	APN	1	72666355	missense	probably damaging	1.00
IGL02445:Ankar	APN	1	72666365	missense	probably benign	0.05
IGL02606:Ankar	APN	1	72690285	missense	possibly damaging	0.61
IGL02635:Ankar	APN	1	72652431	missense	possibly damaging	0.93
IGL02680:Ankar	APN	1	72670116	missense	probably damaging	1.00
IGL02704:Ankar	APN	1	72652343	missense	possibly damaging	0.88
IGL03086:Ankar	APN	1	72643278	missense	possibly damaging	0.84
IGL03269:Ankar	APN	1	72665201	missense	probably damaging	0.99
IGL03368:Ankar	APN	1	72675813	missense	probably damaging	1.00
R0050:Ankar	UTSW	1	72656164	missense	probably damaging	1.00
R0050:Ankar	UTSW	1	72656164	missense	probably damaging	1.00
R0488:Ankar	UTSW	1	72658732	missense	probably damaging	1.00
R0650:Ankar	UTSW	1	72656221	splice site	probably benign
R1121:Ankar	UTSW	1	72651663	splice site	probably null
R1163:Ankar	UTSW	1	72688705	missense	possibly damaging	0.82
R1300:Ankar	UTSW	1	72643164	missense	probably benign	0.00
R1309:Ankar	UTSW	1	72674004	missense	possibly damaging	0.59
R1366:Ankar	UTSW	1	72698649	missense	probably damaging	1.00
R1456:Ankar	UTSW	1	72665118	missense	probably benign	0.34
R1495:Ankar	UTSW	1	72643291	missense	probably benign
R1583:Ankar	UTSW	1	72679555	splice site	probably benign
R1635:Ankar	UTSW	1	72650138	missense	probably damaging	0.99
R1975:Ankar	UTSW	1	72658441	missense	possibly damaging	0.95
R2036:Ankar	UTSW	1	72666530	nonsense	probably null
R2511:Ankar	UTSW	1	72658694	missense	probably damaging	1.00
R2965:Ankar	UTSW	1	72675820	missense	probably benign	0.00
R3404:Ankar	UTSW	1	72643093	nonsense	probably null
R4072:Ankar	UTSW	1	72688592	missense	probably damaging	1.00
R4231:Ankar	UTSW	1	72658542	missense	probably benign	0.23
R4447:Ankar	UTSW	1	72687789	missense	possibly damaging	0.60
R4632:Ankar	UTSW	1	72647184	missense	probably benign	0.01
R4720:Ankar	UTSW	1	72699011	missense	possibly damaging	0.55
R4754:Ankar	UTSW	1	72698694	missense	probably damaging	1.00
R4884:Ankar	UTSW	1	72698807	missense	probably damaging	0.97
R5068:Ankar	UTSW	1	72680210	splice site	probably null
R5069:Ankar	UTSW	1	72680210	splice site	probably null
R5070:Ankar	UTSW	1	72680210	splice site	probably null
R5189:Ankar	UTSW	1	72658414	missense	probably benign	0.01
R5247:Ankar	UTSW	1	72680184	missense	probably benign	0.08
R5322:Ankar	UTSW	1	72690386	splice site	probably null
R5345:Ankar	UTSW	1	72670151	missense	possibly damaging	0.94
R5864:Ankar	UTSW	1	72659165	missense	probably benign	0.00
R5976:Ankar	UTSW	1	72643291	missense	probably benign
R6003:Ankar	UTSW	1	72698887	missense	probably damaging	1.00
R6042:Ankar	UTSW	1	72674054	nonsense	probably null
R6296:Ankar	UTSW	1	72643258	missense	probably damaging	1.00
R6488:Ankar	UTSW	1	72681808	critical splice donor site	probably null
R6885:Ankar	UTSW	1	72643036	missense	unknown
R6985:Ankar	UTSW	1	72658482	missense	probably damaging	1.00
R7060:Ankar	UTSW	1	72656113	missense	probably benign	0.18
R7099:Ankar	UTSW	1	72643293	missense	probably damaging	0.99
R7194:Ankar	UTSW	1	72659033	missense	probably benign	0.32
R7221:Ankar	UTSW	1	72650231	missense	probably damaging	1.00
R7222:Ankar	UTSW	1	72666355	missense	probably damaging	0.99
R7258:Ankar	UTSW	1	72651727	missense	probably benign	0.40
R7303:Ankar	UTSW	1	72659033	missense	probably benign	0.32
R7308:Ankar	UTSW	1	72651794	nonsense	probably null
R7384:Ankar	UTSW	1	72658465	missense	probably benign	0.00
R7424:Ankar	UTSW	1	72680058	missense	probably damaging	1.00
R7464:Ankar	UTSW	1	72698894	missense	possibly damaging	0.94
R7525:Ankar	UTSW	1	72688641	missense	probably benign	0.18
R7618:Ankar	UTSW	1	72675766	missense	probably benign	0.22
R7659:Ankar	UTSW	1	72690135	missense	possibly damaging	0.95
R7974:Ankar	UTSW	1	72698979	nonsense	probably null
R8008:Ankar	UTSW	1	72666484	missense	possibly damaging	0.47
R8119:Ankar	UTSW	1	72647001	missense	probably damaging	0.98
R8244:Ankar	UTSW	1	72651024	missense	probably benign
R8342:Ankar	UTSW	1	72652460	missense	probably damaging	1.00
R8494:Ankar	UTSW	1	72658794	missense	probably benign	0.16
R8851:Ankar	UTSW	1	72652376	missense	probably damaging	1.00
R8970:Ankar	UTSW	1	72652337	critical splice donor site	probably null
R9228:Ankar	UTSW	1	72674051	missense	probably benign	0.27
Z1176:Ankar	UTSW	1	72689961	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CAAAGTGCTATGGCTCCCTG -3'
(R):5'- AAGTGCAGGATGCTATCGC -3'

Sequencing Primer
(F):5'- GCTCCTTAACATCTATTTGAAAGGCC -3'
(R):5'- TATCGCAAAGGAAGGGGCCATC -3'

Posted On

2015-02-18