Mutagenetix > Incidental Mutation

Incidental Mutation 'R3417:Kdm5b'

266826

Institutional Source

Beutler Lab

Gene Symbol

Kdm5b

Ensembl Gene

ENSMUSG00000042207

Gene Name

lysine (K)-specific demethylase 5B

Synonyms

Jarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e

MMRRC Submission

040635-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.269) question?

Stock #

R3417 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

134560171-134635285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 134587977 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 113 (L113P)

Ref Sequence

ENSEMBL: ENSMUSP00000107817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]

AlphaFold

Q80Y84

PDB Structure

Solution structure of the ARID domain of Jarid1b protein [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000047714
AA Change: L113P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: L113P

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	228	239	N/A	INTRINSIC
PHD	311	357	6.15e-14	SMART
JmjC	453	619	2.33e-67	SMART
Pfam:zf-C5HC2	692	744	2.2e-17	PFAM
Pfam:PLU-1	757	1088	5.6e-92	PFAM
low complexity region	1097	1109	N/A	INTRINSIC
PHD	1178	1222	6.2e-10	SMART
low complexity region	1225	1236	N/A	INTRINSIC
low complexity region	1406	1417	N/A	INTRINSIC
low complexity region	1470	1484	N/A	INTRINSIC
PHD	1486	1536	1.18e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112197

SMART Domains

Protein: ENSMUSP00000107816
Gene: ENSMUSG00000042207

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	225	236	N/A	INTRINSIC
PHD	308	354	6.15e-14	SMART
JmjC	450	595	2.6e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112198
AA Change: L113P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: L113P

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	228	239	N/A	INTRINSIC
PHD	311	357	6.15e-14	SMART
JmjC	453	619	2.33e-67	SMART
Pfam:zf-C5HC2	692	745	6.7e-21	PFAM
Pfam:PLU-1	756	1088	6e-94	PFAM
low complexity region	1097	1109	N/A	INTRINSIC
PHD	1178	1222	6.2e-10	SMART
low complexity region	1225	1236	N/A	INTRINSIC
low complexity region	1406	1417	N/A	INTRINSIC
low complexity region	1470	1484	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186128

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	A	C	16: 38,828,740	D2E	probably benign	Het
Abcc5	A	G	16: 20,405,552		probably benign	Het
Adgrl2	T	C	3: 148,859,329	Y201C	probably damaging	Het
Ankar	A	G	1: 72,658,976		probably null	Het
Ankrd17	G	A	5: 90,243,913	T1857I	possibly damaging	Het
Atp6v0d2	A	G	4: 19,888,829		probably benign	Het
Cep170	G	T	1: 176,756,044	P923Q	probably damaging	Het
Cfc1	A	T	1: 34,536,376	R44*	probably null	Het
Col6a1	C	T	10: 76,712,369	V618M	unknown	Het
Crmp1	A	T	5: 37,268,687	I159L	possibly damaging	Het
Crocc	G	A	4: 141,046,447	T103I	possibly damaging	Het
Cyp4f39	T	C	17: 32,489,742	V421A	possibly damaging	Het
Ero1l	T	C	14: 45,287,866	T401A	possibly damaging	Het
Exoc6b	C	G	6: 84,890,565	L288F	possibly damaging	Het
Fsip2	G	A	2: 82,986,510	V4196I	possibly damaging	Het
Gm884	A	T	11: 103,614,609	S2178T	possibly damaging	Het
Icosl	A	T	10: 78,072,035	N143I	possibly damaging	Het
Igsf9b	G	A	9: 27,309,478	V47I	possibly damaging	Het
Jrk	A	G	15: 74,706,885	Y184H	probably damaging	Het
Klhl42	G	A	6: 147,107,880	V406M	probably damaging	Het
Lrp12	A	G	15: 39,878,282	F365L	probably damaging	Het
Map4k5	A	T	12: 69,809,264	V716E	probably damaging	Het
Mcm9	T	C	10: 53,537,407	T1264A	possibly damaging	Het
Mia3	T	A	1: 183,362,100	D100V	probably damaging	Het
Mrgprb2	C	A	7: 48,552,533	R148L	probably damaging	Het
Mrvi1	T	C	7: 110,876,954	T597A	possibly damaging	Het
Mterf1a	A	G	5: 3,890,795	S358P	probably damaging	Het
Myd88	T	C	9: 119,337,490	I253V	possibly damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nqo2	G	T	13: 33,979,633	V92L	probably benign	Het
Olfr730	T	A	14: 50,186,612	T202S	possibly damaging	Het
Pcdhb15	A	T	18: 37,475,163	N483Y	probably damaging	Het
Pds5a	A	G	5: 65,637,892	F667S	probably damaging	Het
Plxnb1	C	A	9: 109,100,760	A228E	probably damaging	Het
Prpsap1	T	C	11: 116,478,584	S179G	probably benign	Het
Rtl4	C	T	X: 145,119,905	Q108*	probably null	Het
Scn8a	A	G	15: 100,971,668		probably benign	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Slc44a1	G	A	4: 53,553,549	V519I	probably benign	Het
Smg1	G	C	7: 118,148,853		probably benign	Het
Sptlc2	A	G	12: 87,346,808		probably benign	Het
St13	A	T	15: 81,369,450		probably benign	Het
Strbp	C	G	2: 37,590,725	R610T	possibly damaging	Het
Tas2r124	A	T	6: 132,755,638	R303S	probably benign	Het
Tgm3	G	A	2: 130,047,772	V629M	possibly damaging	Het
Tnr	T	C	1: 159,895,042	V1019A	probably benign	Het
Ttn	A	T	2: 76,785,564	C14932*	probably null	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het

Other mutations in Kdm5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Kdm5b	APN	1	134620955	missense	probably damaging	1.00
IGL01458:Kdm5b	APN	1	134621986	missense	possibly damaging	0.53
IGL01567:Kdm5b	APN	1	134602540	missense	probably damaging	1.00
IGL01625:Kdm5b	APN	1	134617968	missense	possibly damaging	0.74
IGL01970:Kdm5b	APN	1	134600727	missense	probably damaging	1.00
IGL02183:Kdm5b	APN	1	134624931	missense	probably benign	0.09
IGL02592:Kdm5b	APN	1	134624853	missense	probably damaging	0.99
IGL02695:Kdm5b	APN	1	134604485	missense	possibly damaging	0.94
IGL02697:Kdm5b	APN	1	134588773	splice site	probably benign
IGL03036:Kdm5b	APN	1	134608937	missense	probably damaging	1.00
IGL03056:Kdm5b	APN	1	134587979	missense	probably damaging	0.99
IGL03206:Kdm5b	APN	1	134627317	missense	probably benign
IGL03342:Kdm5b	APN	1	134602576	missense	probably benign	0.00
IGL03388:Kdm5b	APN	1	134627322	missense	probably benign
amaryllis	UTSW	1	134609061	critical splice donor site	probably null
PIT4486001:Kdm5b	UTSW	1	134628685	missense	probably damaging	1.00
R0233:Kdm5b	UTSW	1	134604634	splice site	probably benign
R0334:Kdm5b	UTSW	1	134604522	missense	probably damaging	0.99
R0504:Kdm5b	UTSW	1	134621023	critical splice donor site	probably null
R0505:Kdm5b	UTSW	1	134602571	missense	probably damaging	0.96
R0521:Kdm5b	UTSW	1	134618033	missense	possibly damaging	0.65
R1004:Kdm5b	UTSW	1	134588904	missense	possibly damaging	0.71
R1087:Kdm5b	UTSW	1	134600637	missense	probably damaging	1.00
R1126:Kdm5b	UTSW	1	134613991	missense	possibly damaging	0.90
R1221:Kdm5b	UTSW	1	134599091	missense	probably damaging	0.98
R1230:Kdm5b	UTSW	1	134613254	missense	probably damaging	1.00
R1345:Kdm5b	UTSW	1	134630550	missense	possibly damaging	0.94
R1482:Kdm5b	UTSW	1	134624897	missense	probably damaging	1.00
R1582:Kdm5b	UTSW	1	134624853	missense	probably damaging	0.99
R1653:Kdm5b	UTSW	1	134602481	missense	probably damaging	1.00
R1693:Kdm5b	UTSW	1	134597576	splice site	probably benign
R1721:Kdm5b	UTSW	1	134613181	splice site	probably benign
R1741:Kdm5b	UTSW	1	134618017	missense	possibly damaging	0.82
R1762:Kdm5b	UTSW	1	134604467	nonsense	probably null
R1820:Kdm5b	UTSW	1	134597670	missense	possibly damaging	0.87
R1872:Kdm5b	UTSW	1	134624994	missense	probably damaging	1.00
R1966:Kdm5b	UTSW	1	134613873	splice site	probably null
R2056:Kdm5b	UTSW	1	134613214	missense	probably benign	0.05
R2059:Kdm5b	UTSW	1	134613214	missense	probably benign	0.05
R2405:Kdm5b	UTSW	1	134609016	missense	probably damaging	0.97
R3771:Kdm5b	UTSW	1	134613345	missense	probably damaging	1.00
R3783:Kdm5b	UTSW	1	134630542	missense	probably benign
R3803:Kdm5b	UTSW	1	134615941	missense	probably benign	0.07
R3980:Kdm5b	UTSW	1	134619670	missense	probably benign	0.11
R3983:Kdm5b	UTSW	1	134631304	missense	possibly damaging	0.91
R4013:Kdm5b	UTSW	1	134627329	missense	possibly damaging	0.86
R4162:Kdm5b	UTSW	1	134625161	missense	probably benign	0.01
R4701:Kdm5b	UTSW	1	134606012	intron	probably benign
R4791:Kdm5b	UTSW	1	134630800	missense	possibly damaging	0.82
R4836:Kdm5b	UTSW	1	134593315	splice site	probably null
R4924:Kdm5b	UTSW	1	134631351	missense	probably benign	0.00
R5135:Kdm5b	UTSW	1	134588746	intron	probably benign
R5248:Kdm5b	UTSW	1	134620997	missense	probably benign	0.11
R5290:Kdm5b	UTSW	1	134622099	splice site	probably null
R5358:Kdm5b	UTSW	1	134607694	nonsense	probably null
R5388:Kdm5b	UTSW	1	134608897	nonsense	probably null
R5396:Kdm5b	UTSW	1	134622098	splice site	probably null
R5397:Kdm5b	UTSW	1	134622098	splice site	probably null
R5398:Kdm5b	UTSW	1	134622098	splice site	probably null
R5399:Kdm5b	UTSW	1	134622098	splice site	probably null
R5529:Kdm5b	UTSW	1	134588003	missense	probably damaging	1.00
R5540:Kdm5b	UTSW	1	134631241	missense	probably damaging	0.98
R5661:Kdm5b	UTSW	1	134599073	missense	probably benign	0.01
R5663:Kdm5b	UTSW	1	134630635	missense	probably benign
R5822:Kdm5b	UTSW	1	134588773	splice site	probably benign
R6226:Kdm5b	UTSW	1	134608878	missense	probably damaging	0.99
R6368:Kdm5b	UTSW	1	134599207	missense	probably damaging	1.00
R6681:Kdm5b	UTSW	1	134613269	missense	possibly damaging	0.90
R6715:Kdm5b	UTSW	1	134609061	critical splice donor site	probably null
R7132:Kdm5b	UTSW	1	134599106	missense	probably damaging	1.00
R7202:Kdm5b	UTSW	1	134624759	missense	probably benign
R7258:Kdm5b	UTSW	1	134621021	missense	probably damaging	1.00
R7335:Kdm5b	UTSW	1	134560439	missense	probably damaging	1.00
R7420:Kdm5b	UTSW	1	134604497	missense	probably benign	0.14
R7426:Kdm5b	UTSW	1	134595833	missense	probably benign	0.02
R7452:Kdm5b	UTSW	1	134624948	missense	probably damaging	1.00
R7595:Kdm5b	UTSW	1	134608966	missense	probably benign	0.00
R7612:Kdm5b	UTSW	1	134624918	nonsense	probably null
R7704:Kdm5b	UTSW	1	134587931	missense	probably damaging	1.00
R7846:Kdm5b	UTSW	1	134617840	missense	probably damaging	1.00
R8115:Kdm5b	UTSW	1	134619673	missense	possibly damaging	0.83
R8146:Kdm5b	UTSW	1	134625126	missense	probably benign	0.05
R8160:Kdm5b	UTSW	1	134613919	missense	probably damaging	1.00
R8527:Kdm5b	UTSW	1	134605774	missense	possibly damaging	0.78
R8542:Kdm5b	UTSW	1	134605774	missense	possibly damaging	0.78
R8930:Kdm5b	UTSW	1	134616272	missense	probably damaging	1.00
R8932:Kdm5b	UTSW	1	134616272	missense	probably damaging	1.00
R8950:Kdm5b	UTSW	1	134613926	missense	possibly damaging	0.84
R9089:Kdm5b	UTSW	1	134607768	missense	probably damaging	0.98
R9109:Kdm5b	UTSW	1	134600755	critical splice donor site	probably null
R9133:Kdm5b	UTSW	1	134602585	missense	probably benign
R9298:Kdm5b	UTSW	1	134600755	critical splice donor site	probably null
R9423:Kdm5b	UTSW	1	134587967	missense	possibly damaging	0.85
R9630:Kdm5b	UTSW	1	134585233	critical splice donor site	probably null
R9670:Kdm5b	UTSW	1	134630502	nonsense	probably null
X0063:Kdm5b	UTSW	1	134588876	missense	probably benign	0.07
Z1176:Kdm5b	UTSW	1	134625035	missense	probably damaging	1.00
Z1177:Kdm5b	UTSW	1	134595798	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AAGTGCAGAGCTGTGATGTG -3'
(R):5'- AGGACCCTTTGCAGTGAAAG -3'

Sequencing Primer
(F):5'- TGATGTGCCAGCAGTGTAACCTC -3'
(R):5'- GACCCTTTGCAGTGAAAGATAAATTG -3'

Posted On

2015-02-18