Incidental Mutation 'R3417:Slc44a1'
ID266837
Institutional Source Beutler Lab
Gene Symbol Slc44a1
Ensembl Gene ENSMUSG00000028412
Gene Namesolute carrier family 44, member 1
SynonymsCdw92, 4833416H08Rik, CHTL1, CTL1, 2210409B22Rik
MMRRC Submission 040635-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3417 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location53440413-53622478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53553549 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 519 (V519I)
Ref Sequence ENSEMBL: ENSMUSP00000103278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102911] [ENSMUST00000107645] [ENSMUST00000107646] [ENSMUST00000107647] [ENSMUST00000107651]
Predicted Effect probably benign
Transcript: ENSMUST00000102911
AA Change: V519I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099975
Gene: ENSMUSG00000028412
AA Change: V519I

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Pfam:Choline_transpo 290 610 2.4e-107 PFAM
low complexity region 630 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107645
AA Change: V312I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103272
Gene: ENSMUSG00000028412
AA Change: V312I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
Pfam:Choline_transpo 83 403 4.8e-108 PFAM
low complexity region 423 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107646
SMART Domains Protein: ENSMUSP00000103273
Gene: ENSMUSG00000028412

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Pfam:Choline_transpo 290 500 4.9e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107647
AA Change: V519I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103274
Gene: ENSMUSG00000028412
AA Change: V519I

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Pfam:Choline_transpo 292 607 1.8e-105 PFAM
low complexity region 630 643 N/A INTRINSIC
transmembrane domain 682 704 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107651
AA Change: V519I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103278
Gene: ENSMUSG00000028412
AA Change: V519I

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Pfam:Choline_transpo 290 610 3.5e-108 PFAM
low complexity region 630 643 N/A INTRINSIC
Meta Mutation Damage Score 0.0847 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A C 16: 38,828,740 D2E probably benign Het
Abcc5 A G 16: 20,405,552 probably benign Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Ankar A G 1: 72,658,976 probably null Het
Ankrd17 G A 5: 90,243,913 T1857I possibly damaging Het
Atp6v0d2 A G 4: 19,888,829 probably benign Het
Cep170 G T 1: 176,756,044 P923Q probably damaging Het
Cfc1 A T 1: 34,536,376 R44* probably null Het
Col6a1 C T 10: 76,712,369 V618M unknown Het
Crmp1 A T 5: 37,268,687 I159L possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Ero1l T C 14: 45,287,866 T401A possibly damaging Het
Exoc6b C G 6: 84,890,565 L288F possibly damaging Het
Fsip2 G A 2: 82,986,510 V4196I possibly damaging Het
Gm884 A T 11: 103,614,609 S2178T possibly damaging Het
Icosl A T 10: 78,072,035 N143I possibly damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Jrk A G 15: 74,706,885 Y184H probably damaging Het
Kdm5b T C 1: 134,587,977 L113P probably damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Lrp12 A G 15: 39,878,282 F365L probably damaging Het
Map4k5 A T 12: 69,809,264 V716E probably damaging Het
Mcm9 T C 10: 53,537,407 T1264A possibly damaging Het
Mia3 T A 1: 183,362,100 D100V probably damaging Het
Mrgprb2 C A 7: 48,552,533 R148L probably damaging Het
Mrvi1 T C 7: 110,876,954 T597A possibly damaging Het
Mterf1a A G 5: 3,890,795 S358P probably damaging Het
Myd88 T C 9: 119,337,490 I253V possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nqo2 G T 13: 33,979,633 V92L probably benign Het
Olfr730 T A 14: 50,186,612 T202S possibly damaging Het
Pcdhb15 A T 18: 37,475,163 N483Y probably damaging Het
Pds5a A G 5: 65,637,892 F667S probably damaging Het
Plxnb1 C A 9: 109,100,760 A228E probably damaging Het
Prpsap1 T C 11: 116,478,584 S179G probably benign Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn8a A G 15: 100,971,668 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Smg1 G C 7: 118,148,853 probably benign Het
Sptlc2 A G 12: 87,346,808 probably benign Het
St13 A T 15: 81,369,450 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tnr T C 1: 159,895,042 V1019A probably benign Het
Ttn A T 2: 76,785,564 C14932* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Slc44a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc44a1 APN 4 53543571 missense probably damaging 1.00
IGL00420:Slc44a1 APN 4 53553550 missense possibly damaging 0.86
IGL01369:Slc44a1 APN 4 53491448 missense probably damaging 1.00
IGL01867:Slc44a1 APN 4 53536405 missense probably damaging 1.00
IGL02188:Slc44a1 APN 4 53541361 missense probably benign 0.01
IGL03095:Slc44a1 APN 4 53536374 nonsense probably null
R0517:Slc44a1 UTSW 4 53542366 missense probably damaging 0.99
R0815:Slc44a1 UTSW 4 53536421 missense possibly damaging 0.77
R1437:Slc44a1 UTSW 4 53561006 missense probably damaging 1.00
R1443:Slc44a1 UTSW 4 53561069 missense probably damaging 1.00
R1673:Slc44a1 UTSW 4 53542468 missense probably benign 0.04
R2037:Slc44a1 UTSW 4 53563243 intron probably benign
R2131:Slc44a1 UTSW 4 53563246 frame shift probably null
R3721:Slc44a1 UTSW 4 53491445 missense probably damaging 1.00
R3763:Slc44a1 UTSW 4 53563286 missense probably benign 0.45
R4426:Slc44a1 UTSW 4 53563286 missense probably benign 0.45
R4751:Slc44a1 UTSW 4 53560973 missense probably damaging 1.00
R4993:Slc44a1 UTSW 4 53543644 missense probably damaging 1.00
R5853:Slc44a1 UTSW 4 53528682 missense probably benign 0.00
R6293:Slc44a1 UTSW 4 53561099 missense probably damaging 1.00
R6978:Slc44a1 UTSW 4 53544671 missense probably damaging 1.00
R7164:Slc44a1 UTSW 4 53528711 missense probably benign 0.09
R7838:Slc44a1 UTSW 4 53517657 missense probably benign 0.01
R7921:Slc44a1 UTSW 4 53517657 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACCACGTGAAAGCCATGG -3'
(R):5'- ACCTGCATGCCTGTTAACTCAG -3'

Sequencing Primer
(F):5'- GCCATGGGCTTTATTGAAGAC -3'
(R):5'- GCCTGTTAACTCAGAATAACAGTGC -3'
Posted On2015-02-18