Incidental Mutation 'R3417:Igsf9b'
ID266850
Institutional Source Beutler Lab
Gene Symbol Igsf9b
Ensembl Gene ENSMUSG00000034275
Gene Nameimmunoglobulin superfamily, member 9B
SynonymsLOC235086
MMRRC Submission 040635-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R3417 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location27299204-27357546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27309478 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 47 (V47I)
Ref Sequence ENSEMBL: ENSMUSP00000117017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115247
AA Change: V47I

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275
AA Change: V47I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 30 134 9.41e-9 SMART
IGc2 152 215 1.82e-15 SMART
FN3 232 302 7.02e1 SMART
IGc2 241 310 3.01e-7 SMART
IG 331 417 2.79e-2 SMART
IGc2 433 495 5.48e-10 SMART
FN3 510 591 1.35e-7 SMART
FN3 615 695 3.08e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000133213
AA Change: V47I

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: V47I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 30 134 9.41e-9 SMART
IGc2 152 215 1.82e-15 SMART
FN3 232 302 7.02e1 SMART
IGc2 241 310 3.01e-7 SMART
IG 331 417 2.79e-2 SMART
IGc2 433 495 5.48e-10 SMART
FN3 510 591 1.35e-7 SMART
FN3 615 695 3.08e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
low complexity region 750 760 N/A INTRINSIC
low complexity region 835 843 N/A INTRINSIC
low complexity region 971 982 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
low complexity region 1148 1161 N/A INTRINSIC
low complexity region 1172 1190 N/A INTRINSIC
low complexity region 1246 1273 N/A INTRINSIC
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1313 1326 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000214357
AA Change: V47I

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A C 16: 38,828,740 D2E probably benign Het
Abcc5 A G 16: 20,405,552 probably benign Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Ankar A G 1: 72,658,976 probably null Het
Ankrd17 G A 5: 90,243,913 T1857I possibly damaging Het
Atp6v0d2 A G 4: 19,888,829 probably benign Het
Cep170 G T 1: 176,756,044 P923Q probably damaging Het
Cfc1 A T 1: 34,536,376 R44* probably null Het
Col6a1 C T 10: 76,712,369 V618M unknown Het
Crmp1 A T 5: 37,268,687 I159L possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Ero1l T C 14: 45,287,866 T401A possibly damaging Het
Exoc6b C G 6: 84,890,565 L288F possibly damaging Het
Fsip2 G A 2: 82,986,510 V4196I possibly damaging Het
Gm884 A T 11: 103,614,609 S2178T possibly damaging Het
Icosl A T 10: 78,072,035 N143I possibly damaging Het
Jrk A G 15: 74,706,885 Y184H probably damaging Het
Kdm5b T C 1: 134,587,977 L113P probably damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Lrp12 A G 15: 39,878,282 F365L probably damaging Het
Map4k5 A T 12: 69,809,264 V716E probably damaging Het
Mcm9 T C 10: 53,537,407 T1264A possibly damaging Het
Mia3 T A 1: 183,362,100 D100V probably damaging Het
Mrgprb2 C A 7: 48,552,533 R148L probably damaging Het
Mrvi1 T C 7: 110,876,954 T597A possibly damaging Het
Mterf1a A G 5: 3,890,795 S358P probably damaging Het
Myd88 T C 9: 119,337,490 I253V possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nqo2 G T 13: 33,979,633 V92L probably benign Het
Olfr730 T A 14: 50,186,612 T202S possibly damaging Het
Pcdhb15 A T 18: 37,475,163 N483Y probably damaging Het
Pds5a A G 5: 65,637,892 F667S probably damaging Het
Plxnb1 C A 9: 109,100,760 A228E probably damaging Het
Prpsap1 T C 11: 116,478,584 S179G probably benign Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn8a A G 15: 100,971,668 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc44a1 G A 4: 53,553,549 V519I probably benign Het
Smg1 G C 7: 118,148,853 probably benign Het
Sptlc2 A G 12: 87,346,808 probably benign Het
St13 A T 15: 81,369,450 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tnr T C 1: 159,895,042 V1019A probably benign Het
Ttn A T 2: 76,785,564 C14932* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Igsf9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Igsf9b APN 9 27319655 missense probably damaging 1.00
IGL01013:Igsf9b APN 9 27334304 missense probably damaging 1.00
IGL01960:Igsf9b APN 9 27328606 missense possibly damaging 0.93
IGL02398:Igsf9b APN 9 27333130 missense possibly damaging 0.54
IGL03007:Igsf9b APN 9 27333082 missense probably damaging 0.98
IGL03014:Igsf9b UTSW 9 27322636 missense probably benign 0.00
R0127:Igsf9b UTSW 9 27334385 missense possibly damaging 0.65
R0376:Igsf9b UTSW 9 27334582 missense probably benign 0.01
R0520:Igsf9b UTSW 9 27323250 missense probably benign 0.00
R0534:Igsf9b UTSW 9 27333062 intron probably null
R0613:Igsf9b UTSW 9 27326920 missense probably damaging 1.00
R0718:Igsf9b UTSW 9 27323361 critical splice donor site probably null
R0828:Igsf9b UTSW 9 27319605 nonsense probably null
R0879:Igsf9b UTSW 9 27333742 missense probably damaging 1.00
R0882:Igsf9b UTSW 9 27319316 missense probably damaging 0.98
R0987:Igsf9b UTSW 9 27332553 splice site probably null
R1162:Igsf9b UTSW 9 27326889 missense probably benign
R1758:Igsf9b UTSW 9 27334252 missense possibly damaging 0.50
R1760:Igsf9b UTSW 9 27317827 missense possibly damaging 0.82
R1819:Igsf9b UTSW 9 27311593 missense probably damaging 0.98
R1823:Igsf9b UTSW 9 27331732 missense probably damaging 0.96
R1982:Igsf9b UTSW 9 27322239 missense possibly damaging 0.82
R2150:Igsf9b UTSW 9 27334337 missense probably damaging 1.00
R2228:Igsf9b UTSW 9 27333496 missense probably damaging 1.00
R2229:Igsf9b UTSW 9 27333496 missense probably damaging 1.00
R2250:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R2872:Igsf9b UTSW 9 27322223 missense probably benign 0.11
R2872:Igsf9b UTSW 9 27322223 missense probably benign 0.11
R3415:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R3416:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R3427:Igsf9b UTSW 9 27334577 missense probably damaging 0.99
R4356:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4357:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4358:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4359:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4379:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4416:Igsf9b UTSW 9 27322917 missense probably damaging 1.00
R4445:Igsf9b UTSW 9 27334252 missense probably benign 0.13
R4446:Igsf9b UTSW 9 27334252 missense probably benign 0.13
R4787:Igsf9b UTSW 9 27317456 missense probably benign 0.26
R4887:Igsf9b UTSW 9 27322650 missense probably benign 0.45
R5085:Igsf9b UTSW 9 27317437 missense probably benign 0.03
R5360:Igsf9b UTSW 9 27311672 missense probably damaging 0.98
R5417:Igsf9b UTSW 9 27334276 small insertion probably benign
R5686:Igsf9b UTSW 9 27324179 missense probably damaging 0.99
R5738:Igsf9b UTSW 9 27328530 missense probably damaging 0.98
R5869:Igsf9b UTSW 9 27323235 missense probably benign 0.44
R6304:Igsf9b UTSW 9 27342575 missense probably benign 0.19
R6359:Igsf9b UTSW 9 27309599 missense probably benign 0.25
R6367:Igsf9b UTSW 9 27309525 nonsense probably null
R6556:Igsf9b UTSW 9 27329555 missense probably damaging 1.00
R7058:Igsf9b UTSW 9 27322854 missense probably damaging 0.99
R7165:Igsf9b UTSW 9 27334240 missense probably benign
R7180:Igsf9b UTSW 9 27322668 missense possibly damaging 0.95
R7212:Igsf9b UTSW 9 27331696 missense probably damaging 0.98
R7461:Igsf9b UTSW 9 27334122 missense probably benign 0.10
R7605:Igsf9b UTSW 9 27323312 missense probably damaging 0.98
R7609:Igsf9b UTSW 9 27345890 missense probably benign
R7613:Igsf9b UTSW 9 27334122 missense probably benign 0.10
X0013:Igsf9b UTSW 9 27331725 missense possibly damaging 0.89
X0025:Igsf9b UTSW 9 27309461 missense probably damaging 1.00
X0028:Igsf9b UTSW 9 27334372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATAAGAGATGGGTGTCCTG -3'
(R):5'- AACACAGTCAAAACCTGGGG -3'

Sequencing Primer
(F):5'- GTCCTGGGTGTACTAGGGAC -3'
(R):5'- TACTCAGGGTCCACATGT -3'
Posted On2015-02-18