Incidental Mutation 'R3417:Myd88'
ID 266852
Institutional Source Beutler Lab
Gene Symbol Myd88
Ensembl Gene ENSMUSG00000032508
Gene Name myeloid differentiation primary response gene 88
Synonyms
MMRRC Submission 040635-MU
Accession Numbers

VEGA: OTTMUST00000040319; MGI: 108005
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3417 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 119335934-119341411 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119337490 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 253 (I253V)
Ref Sequence ENSEMBL: ENSMUSP00000035092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035092] [ENSMUST00000039784] [ENSMUST00000139870] [ENSMUST00000170400] [ENSMUST00000175743] [ENSMUST00000176351] [ENSMUST00000176397] [ENSMUST00000177463]
AlphaFold P22366
Predicted Effect possibly damaging
Transcript: ENSMUST00000035092
AA Change: I253V

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035092
Gene: ENSMUSG00000032508
AA Change: I253V

DomainStartEndE-ValueType
DEATH 19 109 7.17e-15 SMART
TIR 160 296 3.39e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039784
SMART Domains Protein: ENSMUSP00000042351
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 38 291 3.6e-88 PFAM
Pfam:Thiolase_C 298 421 3e-53 PFAM
Pfam:ACP_syn_III_C 329 420 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139870
SMART Domains Protein: ENSMUSP00000115746
Gene: ENSMUSG00000032508

DomainStartEndE-ValueType
Pfam:Death 50 109 3.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150837
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175743
SMART Domains Protein: ENSMUSP00000135439
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 291 4.2e-90 PFAM
Pfam:Thiolase_C 298 337 8.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175859
Predicted Effect probably benign
Transcript: ENSMUST00000176351
SMART Domains Protein: ENSMUSP00000134926
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 98 2.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176397
SMART Domains Protein: ENSMUSP00000135191
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 152 4.9e-38 PFAM
Pfam:Thiolase_N 148 246 4.8e-34 PFAM
Pfam:Thiolase_C 214 328 5.9e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176796
Predicted Effect probably benign
Transcript: ENSMUST00000177463
SMART Domains Protein: ENSMUSP00000135310
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 199 3.2e-50 PFAM
Meta Mutation Damage Score 0.1374 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Targeted(9) Gene trapped(4) Chemically induced(5)
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A C 16: 38,828,740 D2E probably benign Het
Abcc5 A G 16: 20,405,552 probably benign Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Ankar A G 1: 72,658,976 probably null Het
Ankrd17 G A 5: 90,243,913 T1857I possibly damaging Het
Atp6v0d2 A G 4: 19,888,829 probably benign Het
Cep170 G T 1: 176,756,044 P923Q probably damaging Het
Cfc1 A T 1: 34,536,376 R44* probably null Het
Col6a1 C T 10: 76,712,369 V618M unknown Het
Crmp1 A T 5: 37,268,687 I159L possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Ero1l T C 14: 45,287,866 T401A possibly damaging Het
Exoc6b C G 6: 84,890,565 L288F possibly damaging Het
Fsip2 G A 2: 82,986,510 V4196I possibly damaging Het
Gm884 A T 11: 103,614,609 S2178T possibly damaging Het
Icosl A T 10: 78,072,035 N143I possibly damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Jrk A G 15: 74,706,885 Y184H probably damaging Het
Kdm5b T C 1: 134,587,977 L113P probably damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Lrp12 A G 15: 39,878,282 F365L probably damaging Het
Map4k5 A T 12: 69,809,264 V716E probably damaging Het
Mcm9 T C 10: 53,537,407 T1264A possibly damaging Het
Mia3 T A 1: 183,362,100 D100V probably damaging Het
Mrgprb2 C A 7: 48,552,533 R148L probably damaging Het
Mrvi1 T C 7: 110,876,954 T597A possibly damaging Het
Mterf1a A G 5: 3,890,795 S358P probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nqo2 G T 13: 33,979,633 V92L probably benign Het
Olfr730 T A 14: 50,186,612 T202S possibly damaging Het
Pcdhb15 A T 18: 37,475,163 N483Y probably damaging Het
Pds5a A G 5: 65,637,892 F667S probably damaging Het
Plxnb1 C A 9: 109,100,760 A228E probably damaging Het
Prpsap1 T C 11: 116,478,584 S179G probably benign Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn8a A G 15: 100,971,668 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc44a1 G A 4: 53,553,549 V519I probably benign Het
Smg1 G C 7: 118,148,853 probably benign Het
Sptlc2 A G 12: 87,346,808 probably benign Het
St13 A T 15: 81,369,450 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tnr T C 1: 159,895,042 V1019A probably benign Het
Ttn A T 2: 76,785,564 C14932* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Myd88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Myd88 APN 9 119337352 unclassified probably benign
Bahia UTSW 9 119338109 splice site probably null
Dani_alves UTSW 9 119337823 missense possibly damaging 0.69
lackadaisical UTSW 9 119338692 missense probably damaging 1.00
Myd88rev1 UTSW 9 119337394 missense possibly damaging 0.90
pococurante UTSW 9 119338114 missense probably damaging 1.00
R1695:Myd88 UTSW 9 119337842 splice site probably null
R1878:Myd88 UTSW 9 119338620 missense probably benign 0.00
R2413:Myd88 UTSW 9 119337418 missense probably benign 0.06
R3836:Myd88 UTSW 9 119338193 unclassified probably benign
R3892:Myd88 UTSW 9 119337816 missense possibly damaging 0.93
R3917:Myd88 UTSW 9 119341398 utr 5 prime probably benign
R4081:Myd88 UTSW 9 119339987 unclassified probably benign
R4634:Myd88 UTSW 9 119338109 splice site probably null
R4637:Myd88 UTSW 9 119338109 splice site probably null
R5091:Myd88 UTSW 9 119337823 missense possibly damaging 0.69
R5604:Myd88 UTSW 9 119339763 missense possibly damaging 0.93
R9243:Myd88 UTSW 9 119339707 missense probably benign
R9415:Myd88 UTSW 9 119338004 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCCCACTACAGTGTCAAAGG -3'
(R):5'- CAAAGCACTACAGATCTCTGAGG -3'

Sequencing Primer
(F):5'- CTACAGTGTCAAAGGAGGCAAGC -3'
(R):5'- TACAGATCTCTGAGGACGGACC -3'
Posted On 2015-02-18