Incidental Mutation 'R3417:Prpsap1'
ID266857
Institutional Source Beutler Lab
Gene Symbol Prpsap1
Ensembl Gene ENSMUSG00000015869
Gene Namephosphoribosyl pyrophosphate synthetase-associated protein 1
Synonyms5730409F23Rik, PAP39
MMRRC Submission 040635-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R3417 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116470845-116494202 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116478584 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 179 (S179G)
Ref Sequence ENSEMBL: ENSMUSP00000119576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106391] [ENSMUST00000135196] [ENSMUST00000152496]
Predicted Effect probably benign
Transcript: ENSMUST00000106391
AA Change: S174G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101999
Gene: ENSMUSG00000015869
AA Change: S174G

DomainStartEndE-ValueType
low complexity region 5 34 N/A INTRINSIC
Pfam:Pribosyltran_N 38 155 4.8e-41 PFAM
Pfam:Pribosyl_synth 196 379 1.1e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130835
Predicted Effect probably benign
Transcript: ENSMUST00000135196
AA Change: S179G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000119576
Gene: ENSMUSG00000015869
AA Change: S179G

DomainStartEndE-ValueType
low complexity region 5 34 N/A INTRINSIC
Pfam:Pribosyltran_N 38 160 2.9e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142480
Predicted Effect probably benign
Transcript: ENSMUST00000152496
AA Change: S138G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000115982
Gene: ENSMUSG00000015869
AA Change: S138G

DomainStartEndE-ValueType
Pfam:Pribosyltran_N 17 119 1.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152874
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A C 16: 38,828,740 D2E probably benign Het
Abcc5 A G 16: 20,405,552 probably benign Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Ankar A G 1: 72,658,976 probably null Het
Ankrd17 G A 5: 90,243,913 T1857I possibly damaging Het
Atp6v0d2 A G 4: 19,888,829 probably benign Het
Cep170 G T 1: 176,756,044 P923Q probably damaging Het
Cfc1 A T 1: 34,536,376 R44* probably null Het
Col6a1 C T 10: 76,712,369 V618M unknown Het
Crmp1 A T 5: 37,268,687 I159L possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Ero1l T C 14: 45,287,866 T401A possibly damaging Het
Exoc6b C G 6: 84,890,565 L288F possibly damaging Het
Fsip2 G A 2: 82,986,510 V4196I possibly damaging Het
Gm884 A T 11: 103,614,609 S2178T possibly damaging Het
Icosl A T 10: 78,072,035 N143I possibly damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Jrk A G 15: 74,706,885 Y184H probably damaging Het
Kdm5b T C 1: 134,587,977 L113P probably damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Lrp12 A G 15: 39,878,282 F365L probably damaging Het
Map4k5 A T 12: 69,809,264 V716E probably damaging Het
Mcm9 T C 10: 53,537,407 T1264A possibly damaging Het
Mia3 T A 1: 183,362,100 D100V probably damaging Het
Mrgprb2 C A 7: 48,552,533 R148L probably damaging Het
Mrvi1 T C 7: 110,876,954 T597A possibly damaging Het
Mterf1a A G 5: 3,890,795 S358P probably damaging Het
Myd88 T C 9: 119,337,490 I253V possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nqo2 G T 13: 33,979,633 V92L probably benign Het
Olfr730 T A 14: 50,186,612 T202S possibly damaging Het
Pcdhb15 A T 18: 37,475,163 N483Y probably damaging Het
Pds5a A G 5: 65,637,892 F667S probably damaging Het
Plxnb1 C A 9: 109,100,760 A228E probably damaging Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn8a A G 15: 100,971,668 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc44a1 G A 4: 53,553,549 V519I probably benign Het
Smg1 G C 7: 118,148,853 probably benign Het
Sptlc2 A G 12: 87,346,808 probably benign Het
St13 A T 15: 81,369,450 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tnr T C 1: 159,895,042 V1019A probably benign Het
Ttn A T 2: 76,785,564 C14932* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Prpsap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0042:Prpsap1 UTSW 11 116479656 missense probably benign 0.42
R0684:Prpsap1 UTSW 11 116471491 missense probably damaging 1.00
R1538:Prpsap1 UTSW 11 116479708 missense probably benign 0.09
R2429:Prpsap1 UTSW 11 116472235 missense probably damaging 1.00
R3415:Prpsap1 UTSW 11 116478584 missense probably benign 0.01
R4035:Prpsap1 UTSW 11 116473008 missense probably benign 0.17
R5223:Prpsap1 UTSW 11 116488148 missense probably benign 0.09
R6216:Prpsap1 UTSW 11 116471413 missense probably damaging 1.00
R6875:Prpsap1 UTSW 11 116471438 missense probably damaging 1.00
R7086:Prpsap1 UTSW 11 116477283 missense probably benign
R7159:Prpsap1 UTSW 11 116494044 missense probably benign 0.26
R7999:Prpsap1 UTSW 11 116490216 start codon destroyed probably null
Z1176:Prpsap1 UTSW 11 116478618 missense possibly damaging 0.49
Z1176:Prpsap1 UTSW 11 116479768 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCCTCCATAACTAAGCGCTG -3'
(R):5'- AGTAGCGTTTGTGCCCCTAG -3'

Sequencing Primer
(F):5'- CTATCCGGCCGTGGTGG -3'
(R):5'- TGTGCCCCTAGTTCACGGTG -3'
Posted On2015-02-18