Incidental Mutation 'R3417:Sptlc2'
ID266859
Institutional Source Beutler Lab
Gene Symbol Sptlc2
Ensembl Gene ENSMUSG00000021036
Gene Nameserine palmitoyltransferase, long chain base subunit 2
SynonymsLCB2
MMRRC Submission 040635-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3417 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location87305058-87388355 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 87346808 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021424]
Predicted Effect probably benign
Transcript: ENSMUST00000021424
SMART Domains Protein: ENSMUSP00000021424
Gene: ENSMUSG00000021036

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 166 526 7.2e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170110
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This gene encodes a long chain base subunit of serine palmitoyltransferase. The enzyme, serine palmitoyltransferase, consists of two different subunits, and is the key enzyme in sphingolipid biosynthesis. It catalyzes the pyridoxal-5-prime-phosphate-dependent condensation of L-serine and palmitoyl-CoA to 3-oxosphinganine. A mutant allele of this gene in mice is used as a model for the human disease 'Susceptibilty to Psoriasis 1'. Mutations in the human gene are associated with hereditary sensory neuropathy type I. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit abnormal liver and circulating shingolipid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A C 16: 38,828,740 D2E probably benign Het
Abcc5 A G 16: 20,405,552 probably benign Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Ankar A G 1: 72,658,976 probably null Het
Ankrd17 G A 5: 90,243,913 T1857I possibly damaging Het
Atp6v0d2 A G 4: 19,888,829 probably benign Het
Cep170 G T 1: 176,756,044 P923Q probably damaging Het
Cfc1 A T 1: 34,536,376 R44* probably null Het
Col6a1 C T 10: 76,712,369 V618M unknown Het
Crmp1 A T 5: 37,268,687 I159L possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Ero1l T C 14: 45,287,866 T401A possibly damaging Het
Exoc6b C G 6: 84,890,565 L288F possibly damaging Het
Fsip2 G A 2: 82,986,510 V4196I possibly damaging Het
Gm884 A T 11: 103,614,609 S2178T possibly damaging Het
Icosl A T 10: 78,072,035 N143I possibly damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Jrk A G 15: 74,706,885 Y184H probably damaging Het
Kdm5b T C 1: 134,587,977 L113P probably damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Lrp12 A G 15: 39,878,282 F365L probably damaging Het
Map4k5 A T 12: 69,809,264 V716E probably damaging Het
Mcm9 T C 10: 53,537,407 T1264A possibly damaging Het
Mia3 T A 1: 183,362,100 D100V probably damaging Het
Mrgprb2 C A 7: 48,552,533 R148L probably damaging Het
Mrvi1 T C 7: 110,876,954 T597A possibly damaging Het
Mterf1a A G 5: 3,890,795 S358P probably damaging Het
Myd88 T C 9: 119,337,490 I253V possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nqo2 G T 13: 33,979,633 V92L probably benign Het
Olfr730 T A 14: 50,186,612 T202S possibly damaging Het
Pcdhb15 A T 18: 37,475,163 N483Y probably damaging Het
Pds5a A G 5: 65,637,892 F667S probably damaging Het
Plxnb1 C A 9: 109,100,760 A228E probably damaging Het
Prpsap1 T C 11: 116,478,584 S179G probably benign Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn8a A G 15: 100,971,668 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc44a1 G A 4: 53,553,549 V519I probably benign Het
Smg1 G C 7: 118,148,853 probably benign Het
St13 A T 15: 81,369,450 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tnr T C 1: 159,895,042 V1019A probably benign Het
Ttn A T 2: 76,785,564 C14932* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Sptlc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Sptlc2 APN 12 87369068 missense probably damaging 0.99
IGL02458:Sptlc2 APN 12 87309893 utr 3 prime probably benign
IGL02734:Sptlc2 APN 12 87355670 missense probably damaging 0.97
IGL03252:Sptlc2 APN 12 87355657 missense probably benign 0.00
lopsided UTSW 12 87341565 missense probably benign 0.27
shinola UTSW 12 87350295 missense possibly damaging 0.64
R0087:Sptlc2 UTSW 12 87369118 missense probably benign
R0116:Sptlc2 UTSW 12 87356680 missense probably benign 0.00
R0492:Sptlc2 UTSW 12 87346806 splice site probably null
R1353:Sptlc2 UTSW 12 87341746 missense probably damaging 1.00
R1470:Sptlc2 UTSW 12 87355640 missense probably benign 0.00
R1470:Sptlc2 UTSW 12 87355640 missense probably benign 0.00
R3735:Sptlc2 UTSW 12 87341565 missense probably benign 0.27
R3736:Sptlc2 UTSW 12 87341565 missense probably benign 0.27
R4278:Sptlc2 UTSW 12 87336151 missense probably benign 0.04
R5252:Sptlc2 UTSW 12 87336055 missense possibly damaging 0.49
R5593:Sptlc2 UTSW 12 87369083 missense probably benign 0.11
R5656:Sptlc2 UTSW 12 87346761 missense probably damaging 1.00
R5801:Sptlc2 UTSW 12 87341771 splice site probably null
R6256:Sptlc2 UTSW 12 87355531 missense probably damaging 1.00
R6280:Sptlc2 UTSW 12 87388131 missense probably benign
R6520:Sptlc2 UTSW 12 87355662 missense probably benign
R6808:Sptlc2 UTSW 12 87350295 missense possibly damaging 0.64
R7133:Sptlc2 UTSW 12 87350377 missense probably benign 0.00
R7274:Sptlc2 UTSW 12 87341606 missense probably benign 0.24
R7366:Sptlc2 UTSW 12 87314049 critical splice donor site probably null
R7602:Sptlc2 UTSW 12 87341689 missense probably damaging 0.99
Z1177:Sptlc2 UTSW 12 87369044 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTACGTAATCACTAACACTGTCC -3'
(R):5'- AGCACCATTTCTACAGCTGCC -3'

Sequencing Primer
(F):5'- ATCACTAACACTGTCCAAAGAATATC -3'
(R):5'- ACAGCTGCCCTTTCTCAAAAATTG -3'
Posted On2015-02-18