Incidental Mutation 'R3417:Nqo2'
ID266860
Institutional Source Beutler Lab
Gene Symbol Nqo2
Ensembl Gene ENSMUSG00000046949
Gene NameN-ribosyldihydronicotinamide quinone reductase 2
SynonymsNmor2, Ox-2, NRH: quinone oxidoreductase, Ox2
MMRRC Submission 040635-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R3417 (G1)
Quality Score219
Status Validated
Chromosome13
Chromosomal Location33964687-33988443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33979633 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 92 (V92L)
Ref Sequence ENSEMBL: ENSMUSP00000152294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021843] [ENSMUST00000058978] [ENSMUST00000076532] [ENSMUST00000166354] [ENSMUST00000167237] [ENSMUST00000168400] [ENSMUST00000171034] [ENSMUST00000220844] [ENSMUST00000222740] [ENSMUST00000223479]
Predicted Effect probably benign
Transcript: ENSMUST00000021843
AA Change: V92L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000021843
Gene: ENSMUSG00000046949
AA Change: V92L

DomainStartEndE-ValueType
Pfam:FMN_red 4 159 5.6e-15 PFAM
Pfam:Flavodoxin_2 4 212 3.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058978
AA Change: V92L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000053809
Gene: ENSMUSG00000046949
AA Change: V92L

DomainStartEndE-ValueType
Pfam:FMN_red 4 158 2e-14 PFAM
Pfam:Flavodoxin_2 4 212 2.6e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076532
SMART Domains Protein: ENSMUSP00000075848
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166354
SMART Domains Protein: ENSMUSP00000126287
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
Pfam:Serpin 6 66 3.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167597
Predicted Effect probably benign
Transcript: ENSMUST00000168400
SMART Domains Protein: ENSMUSP00000126450
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
Pfam:Serpin 6 120 3.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171034
SMART Domains Protein: ENSMUSP00000132433
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 228 3.54e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220844
AA Change: V48L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000222740
AA Change: V92L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000223479
AA Change: V92L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygouse for disruptions in this gene have an essentially normal phenotype but with abnormalities in WBC counts and increased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A C 16: 38,828,740 D2E probably benign Het
Abcc5 A G 16: 20,405,552 probably benign Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Ankar A G 1: 72,658,976 probably null Het
Ankrd17 G A 5: 90,243,913 T1857I possibly damaging Het
Atp6v0d2 A G 4: 19,888,829 probably benign Het
Cep170 G T 1: 176,756,044 P923Q probably damaging Het
Cfc1 A T 1: 34,536,376 R44* probably null Het
Col6a1 C T 10: 76,712,369 V618M unknown Het
Crmp1 A T 5: 37,268,687 I159L possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Ero1l T C 14: 45,287,866 T401A possibly damaging Het
Exoc6b C G 6: 84,890,565 L288F possibly damaging Het
Fsip2 G A 2: 82,986,510 V4196I possibly damaging Het
Gm884 A T 11: 103,614,609 S2178T possibly damaging Het
Icosl A T 10: 78,072,035 N143I possibly damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Jrk A G 15: 74,706,885 Y184H probably damaging Het
Kdm5b T C 1: 134,587,977 L113P probably damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Lrp12 A G 15: 39,878,282 F365L probably damaging Het
Map4k5 A T 12: 69,809,264 V716E probably damaging Het
Mcm9 T C 10: 53,537,407 T1264A possibly damaging Het
Mia3 T A 1: 183,362,100 D100V probably damaging Het
Mrgprb2 C A 7: 48,552,533 R148L probably damaging Het
Mrvi1 T C 7: 110,876,954 T597A possibly damaging Het
Mterf1a A G 5: 3,890,795 S358P probably damaging Het
Myd88 T C 9: 119,337,490 I253V possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr730 T A 14: 50,186,612 T202S possibly damaging Het
Pcdhb15 A T 18: 37,475,163 N483Y probably damaging Het
Pds5a A G 5: 65,637,892 F667S probably damaging Het
Plxnb1 C A 9: 109,100,760 A228E probably damaging Het
Prpsap1 T C 11: 116,478,584 S179G probably benign Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn8a A G 15: 100,971,668 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc44a1 G A 4: 53,553,549 V519I probably benign Het
Smg1 G C 7: 118,148,853 probably benign Het
Sptlc2 A G 12: 87,346,808 probably benign Het
St13 A T 15: 81,369,450 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tnr T C 1: 159,895,042 V1019A probably benign Het
Ttn A T 2: 76,785,564 C14932* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Nqo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Nqo2 APN 13 33985343 nonsense probably null
IGL02884:Nqo2 APN 13 33972361 missense probably damaging 1.00
R0021:Nqo2 UTSW 13 33981507 missense probably benign
R0021:Nqo2 UTSW 13 33981507 missense probably benign
R0848:Nqo2 UTSW 13 33972478 critical splice donor site probably null
R0853:Nqo2 UTSW 13 33979577 missense probably benign
R4110:Nqo2 UTSW 13 33979637 missense probably benign 0.00
R4936:Nqo2 UTSW 13 33981518 missense probably damaging 1.00
R5861:Nqo2 UTSW 13 33972430 missense probably damaging 1.00
R6161:Nqo2 UTSW 13 33979651 missense probably damaging 0.99
R6599:Nqo2 UTSW 13 33979556 missense probably damaging 1.00
R7909:Nqo2 UTSW 13 33972431 missense probably damaging 1.00
R7990:Nqo2 UTSW 13 33972431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAAGGCTTTGGTGAGCTC -3'
(R):5'- ACTGCAGTAGGTAAGTGTTCTAACTAG -3'

Sequencing Primer
(F):5'- TTTGGTGAGCTCAGACCAC -3'
(R):5'- CAGTTCCAAAAGCAGTGTTC -3'
Posted On2015-02-18