Incidental Mutation 'R3417:Ero1l'
ID266862
Institutional Source Beutler Lab
Gene Symbol Ero1l
Ensembl Gene ENSMUSG00000021831
Gene NameERO1-like (S. cerevisiae)
Synonyms
MMRRC Submission 040635-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R3417 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location45283087-45318771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45287866 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 401 (T401A)
Ref Sequence ENSEMBL: ENSMUSP00000022378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022378]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022378
AA Change: T401A

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022378
Gene: ENSMUSG00000021831
AA Change: T401A

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:ERO1 60 453 3.7e-128 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000227147
AA Change: T186A
Meta Mutation Damage Score 0.5984 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This gene encodes a member of the endoplasmic reticulum oxidoreductin family. The encoded protein is localized to the endoplasmic reticulum and promotes the formation of disulfide bonds by oxidizing protein disulfide isomerase. This gene may play a role in endoplasmic reticulum stress-induced apoptosis and the cellular response to hypoxia. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased apoptosis and calcium release in macrophages exposed to endoplasmic reticulum stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A C 16: 38,828,740 D2E probably benign Het
Abcc5 A G 16: 20,405,552 probably benign Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Ankar A G 1: 72,658,976 probably null Het
Ankrd17 G A 5: 90,243,913 T1857I possibly damaging Het
Atp6v0d2 A G 4: 19,888,829 probably benign Het
Cep170 G T 1: 176,756,044 P923Q probably damaging Het
Cfc1 A T 1: 34,536,376 R44* probably null Het
Col6a1 C T 10: 76,712,369 V618M unknown Het
Crmp1 A T 5: 37,268,687 I159L possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Exoc6b C G 6: 84,890,565 L288F possibly damaging Het
Fsip2 G A 2: 82,986,510 V4196I possibly damaging Het
Gm884 A T 11: 103,614,609 S2178T possibly damaging Het
Icosl A T 10: 78,072,035 N143I possibly damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Jrk A G 15: 74,706,885 Y184H probably damaging Het
Kdm5b T C 1: 134,587,977 L113P probably damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Lrp12 A G 15: 39,878,282 F365L probably damaging Het
Map4k5 A T 12: 69,809,264 V716E probably damaging Het
Mcm9 T C 10: 53,537,407 T1264A possibly damaging Het
Mia3 T A 1: 183,362,100 D100V probably damaging Het
Mrgprb2 C A 7: 48,552,533 R148L probably damaging Het
Mrvi1 T C 7: 110,876,954 T597A possibly damaging Het
Mterf1a A G 5: 3,890,795 S358P probably damaging Het
Myd88 T C 9: 119,337,490 I253V possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nqo2 G T 13: 33,979,633 V92L probably benign Het
Olfr730 T A 14: 50,186,612 T202S possibly damaging Het
Pcdhb15 A T 18: 37,475,163 N483Y probably damaging Het
Pds5a A G 5: 65,637,892 F667S probably damaging Het
Plxnb1 C A 9: 109,100,760 A228E probably damaging Het
Prpsap1 T C 11: 116,478,584 S179G probably benign Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn8a A G 15: 100,971,668 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc44a1 G A 4: 53,553,549 V519I probably benign Het
Smg1 G C 7: 118,148,853 probably benign Het
Sptlc2 A G 12: 87,346,808 probably benign Het
St13 A T 15: 81,369,450 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tnr T C 1: 159,895,042 V1019A probably benign Het
Ttn A T 2: 76,785,564 C14932* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Ero1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Ero1l APN 14 45303586 missense probably benign 0.19
IGL01672:Ero1l APN 14 45292430 missense probably benign 0.05
IGL01914:Ero1l APN 14 45306612 missense probably damaging 1.00
IGL01979:Ero1l APN 14 45287744 missense probably damaging 1.00
IGL02302:Ero1l APN 14 45293162 missense probably benign 0.34
IGL03351:Ero1l APN 14 45294533 missense probably benign
R0844:Ero1l UTSW 14 45293000 missense probably damaging 1.00
R1696:Ero1l UTSW 14 45299935 missense probably damaging 1.00
R1828:Ero1l UTSW 14 45287760 missense probably damaging 1.00
R2410:Ero1l UTSW 14 45305266 missense possibly damaging 0.89
R2504:Ero1l UTSW 14 45299088 splice site probably null
R3415:Ero1l UTSW 14 45287866 missense possibly damaging 0.91
R4074:Ero1l UTSW 14 45292436 splice site probably null
R6369:Ero1l UTSW 14 45299958 missense probably damaging 0.99
R6899:Ero1l UTSW 14 45292939 missense probably benign 0.00
R7052:Ero1l UTSW 14 45306583 nonsense probably null
R7064:Ero1l UTSW 14 45306592 missense probably damaging 0.96
R7516:Ero1l UTSW 14 45288023 missense probably benign 0.06
R7520:Ero1l UTSW 14 45306575 missense probably damaging 1.00
Z1176:Ero1l UTSW 14 45299890 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCTAGCAGAAGCAGTTTC -3'
(R):5'- TCACGGAAAGCACTGGGAAC -3'

Sequencing Primer
(F):5'- CTAGCAGAAGCAGTTTCAGGACATC -3'
(R):5'- GAGGACTTCCGGCTACACTTTAG -3'
Posted On2015-02-18