Incidental Mutation 'R3417:Jrk'
ID266865
Institutional Source Beutler Lab
Gene Symbol Jrk
Ensembl Gene ENSMUSG00000046380
Gene Namejerky
Synonyms
MMRRC Submission 040635-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R3417 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location74702301-74709535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74706885 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 184 (Y184H)
Ref Sequence ENSEMBL: ENSMUSP00000051842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050234]
Predicted Effect probably damaging
Transcript: ENSMUST00000050234
AA Change: Y184H

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051842
Gene: ENSMUSG00000046380
AA Change: Y184H

DomainStartEndE-ValueType
Pfam:CENP-B_N 14 66 5.3e-27 PFAM
CENPB 83 149 8.82e-24 SMART
Pfam:DDE_1 213 382 2.2e-46 PFAM
low complexity region 395 405 N/A INTRINSIC
low complexity region 468 481 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056711
SMART Domains Protein: ENSMUSP00000060582
Gene: ENSMUSG00000044276

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185751
Meta Mutation Damage Score 0.1086 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein that is similar to DNA-binding proteins, such as major centromere autoantigen B (CENPB). Inactivation of the related gene in mice resulted in epileptic seizures. Childhood Absence Epilepsy (CAE) has been mapped to the same chromosomal location (8q24.3) as this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Heterozygous mutants show whole body jerks, clonic seizures and epileptic brain activity. Homozygous mutants show elevated seizure susceptibility, impaired postnatal growth, reduced life span, male sterility and impaired female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A C 16: 38,828,740 D2E probably benign Het
Abcc5 A G 16: 20,405,552 probably benign Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Ankar A G 1: 72,658,976 probably null Het
Ankrd17 G A 5: 90,243,913 T1857I possibly damaging Het
Atp6v0d2 A G 4: 19,888,829 probably benign Het
Cep170 G T 1: 176,756,044 P923Q probably damaging Het
Cfc1 A T 1: 34,536,376 R44* probably null Het
Col6a1 C T 10: 76,712,369 V618M unknown Het
Crmp1 A T 5: 37,268,687 I159L possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Ero1l T C 14: 45,287,866 T401A possibly damaging Het
Exoc6b C G 6: 84,890,565 L288F possibly damaging Het
Fsip2 G A 2: 82,986,510 V4196I possibly damaging Het
Gm884 A T 11: 103,614,609 S2178T possibly damaging Het
Icosl A T 10: 78,072,035 N143I possibly damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kdm5b T C 1: 134,587,977 L113P probably damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Lrp12 A G 15: 39,878,282 F365L probably damaging Het
Map4k5 A T 12: 69,809,264 V716E probably damaging Het
Mcm9 T C 10: 53,537,407 T1264A possibly damaging Het
Mia3 T A 1: 183,362,100 D100V probably damaging Het
Mrgprb2 C A 7: 48,552,533 R148L probably damaging Het
Mrvi1 T C 7: 110,876,954 T597A possibly damaging Het
Mterf1a A G 5: 3,890,795 S358P probably damaging Het
Myd88 T C 9: 119,337,490 I253V possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nqo2 G T 13: 33,979,633 V92L probably benign Het
Olfr730 T A 14: 50,186,612 T202S possibly damaging Het
Pcdhb15 A T 18: 37,475,163 N483Y probably damaging Het
Pds5a A G 5: 65,637,892 F667S probably damaging Het
Plxnb1 C A 9: 109,100,760 A228E probably damaging Het
Prpsap1 T C 11: 116,478,584 S179G probably benign Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn8a A G 15: 100,971,668 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc44a1 G A 4: 53,553,549 V519I probably benign Het
Smg1 G C 7: 118,148,853 probably benign Het
Sptlc2 A G 12: 87,346,808 probably benign Het
St13 A T 15: 81,369,450 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tnr T C 1: 159,895,042 V1019A probably benign Het
Ttn A T 2: 76,785,564 C14932* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Jrk
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0144:Jrk UTSW 15 74706156 missense probably benign 0.01
R1871:Jrk UTSW 15 74706563 missense possibly damaging 0.91
R4867:Jrk UTSW 15 74707220 missense probably benign 0.00
R5294:Jrk UTSW 15 74707336 missense possibly damaging 0.88
R5769:Jrk UTSW 15 74706068 missense probably benign 0.19
R5911:Jrk UTSW 15 74705768 missense possibly damaging 0.88
R6123:Jrk UTSW 15 74706680 missense possibly damaging 0.46
R6176:Jrk UTSW 15 74706340 missense possibly damaging 0.47
R7411:Jrk UTSW 15 74707199 missense possibly damaging 0.47
R7480:Jrk UTSW 15 74707053 missense probably benign 0.16
Z1088:Jrk UTSW 15 74707394 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGTCTACCCAGGCATTACCCT -3'
(R):5'- GTTCTTCGCCAGCTCAGACTC -3'

Sequencing Primer
(F):5'- TACCCTGGGCCTTGTAAGCAATAG -3'
(R):5'- GGCCCTATGCTCATCGAAAAGG -3'
Posted On2015-02-18