Incidental Mutation 'R3417:Rtl4'
ID266872
Institutional Source Beutler Lab
Gene Symbol Rtl4
Ensembl Gene ENSMUSG00000071679
Gene Nameretrotransposon Gag like 4
SynonymsMar4, Zcchc16, C230031A03Rik
MMRRC Submission 040635-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3417 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location144688907-145122411 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 145119905 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 108 (Q108*)
Ref Sequence ENSEMBL: ENSMUSP00000108462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096301] [ENSMUST00000112843]
Predicted Effect probably null
Transcript: ENSMUST00000096301
AA Change: Q108*
SMART Domains Protein: ENSMUSP00000108463
Gene: ENSMUSG00000071679
AA Change: Q108*

DomainStartEndE-ValueType
ZnF_C2HC 277 293 6.8e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112843
AA Change: Q108*
SMART Domains Protein: ENSMUSP00000108462
Gene: ENSMUSG00000071679
AA Change: Q108*

DomainStartEndE-ValueType
ZnF_C2HC 277 293 6.8e-2 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A C 16: 38,828,740 D2E probably benign Het
Abcc5 A G 16: 20,405,552 probably benign Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Ankar A G 1: 72,658,976 probably null Het
Ankrd17 G A 5: 90,243,913 T1857I possibly damaging Het
Atp6v0d2 A G 4: 19,888,829 probably benign Het
Cep170 G T 1: 176,756,044 P923Q probably damaging Het
Cfc1 A T 1: 34,536,376 R44* probably null Het
Col6a1 C T 10: 76,712,369 V618M unknown Het
Crmp1 A T 5: 37,268,687 I159L possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Ero1l T C 14: 45,287,866 T401A possibly damaging Het
Exoc6b C G 6: 84,890,565 L288F possibly damaging Het
Fsip2 G A 2: 82,986,510 V4196I possibly damaging Het
Gm884 A T 11: 103,614,609 S2178T possibly damaging Het
Icosl A T 10: 78,072,035 N143I possibly damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Jrk A G 15: 74,706,885 Y184H probably damaging Het
Kdm5b T C 1: 134,587,977 L113P probably damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Lrp12 A G 15: 39,878,282 F365L probably damaging Het
Map4k5 A T 12: 69,809,264 V716E probably damaging Het
Mcm9 T C 10: 53,537,407 T1264A possibly damaging Het
Mia3 T A 1: 183,362,100 D100V probably damaging Het
Mrgprb2 C A 7: 48,552,533 R148L probably damaging Het
Mrvi1 T C 7: 110,876,954 T597A possibly damaging Het
Mterf1a A G 5: 3,890,795 S358P probably damaging Het
Myd88 T C 9: 119,337,490 I253V possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nqo2 G T 13: 33,979,633 V92L probably benign Het
Olfr730 T A 14: 50,186,612 T202S possibly damaging Het
Pcdhb15 A T 18: 37,475,163 N483Y probably damaging Het
Pds5a A G 5: 65,637,892 F667S probably damaging Het
Plxnb1 C A 9: 109,100,760 A228E probably damaging Het
Prpsap1 T C 11: 116,478,584 S179G probably benign Het
Scn8a A G 15: 100,971,668 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc44a1 G A 4: 53,553,549 V519I probably benign Het
Smg1 G C 7: 118,148,853 probably benign Het
Sptlc2 A G 12: 87,346,808 probably benign Het
St13 A T 15: 81,369,450 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tnr T C 1: 159,895,042 V1019A probably benign Het
Ttn A T 2: 76,785,564 C14932* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Rtl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3416:Rtl4 UTSW X 145119905 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACAGGGCAAGTTGTACCTGC -3'
(R):5'- CTCAAATTTGGAGCATGAAGTTGG -3'

Sequencing Primer
(F):5'- TGAATACCCCAGTGATGTCTG -3'
(R):5'- TGGAAATTAGTAGCATCCTGTGGAG -3'
Posted On2015-02-18