Incidental Mutation 'R3418:Tnfrsf11a'
ID266877
Institutional Source Beutler Lab
Gene Symbol Tnfrsf11a
Ensembl Gene ENSMUSG00000026321
Gene Nametumor necrosis factor receptor superfamily, member 11a, NFKB activator
SynonymsTRANCE-R, Rank
MMRRC Submission 040636-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R3418 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location105780718-105847981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105809405 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 79 (D79G)
Ref Sequence ENSEMBL: ENSMUSP00000027559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027559]
PDB Structure
Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION]
Crystal structure of mouse RANK [X-RAY DIFFRACTION]
Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION]
Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027559
AA Change: D79G

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027559
Gene: ENSMUSG00000026321
AA Change: D79G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
TNFR 35 69 1.48e-7 SMART
TNFR 72 113 2.59e-3 SMART
TNFR 115 152 4.28e-4 SMART
TNFR 155 195 5.27e-4 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 300 313 N/A INTRINSIC
low complexity region 495 511 N/A INTRINSIC
low complexity region 543 558 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187812
Meta Mutation Damage Score 0.1378 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptors can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. This receptor and its ligand are important regulators of the interaction between T cells and dendritic cells. This receptor is also an essential mediator for osteoclast and lymph node development. Mutations at this locus have been associated with familial expansile osteolysis, autosomal recessive osteopetrosis, and Paget disease of bone. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out or spontaneous allele exhibit a failure of tooth eruption, osteopetrosis, and abnormal immune system morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Acaa1a A G 9: 119,349,490 probably null Het
Agbl5 T C 5: 30,904,723 S756P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Cdc16 C T 8: 13,769,489 Q362* probably null Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Cep170b C T 12: 112,738,468 Q887* probably null Het
Chd9 T C 8: 91,036,591 I2348T probably damaging Het
Clec9a A G 6: 129,421,038 probably benign Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
D130040H23Rik T C 8: 69,302,927 I328T probably benign Het
Dido1 G T 2: 180,660,935 D1725E possibly damaging Het
Dnajb14 A G 3: 137,892,870 D123G probably null Het
Dock2 A T 11: 34,689,760 M661K probably damaging Het
Esam C T 9: 37,537,130 probably null Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fat2 G T 11: 55,278,998 H2978Q probably benign Het
Fbn1 T C 2: 125,320,926 T2147A possibly damaging Het
Fdft1 T C 14: 63,156,621 T214A probably damaging Het
Fhl5 T C 4: 25,211,252 S147G probably benign Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gcat A T 15: 79,042,097 T56S possibly damaging Het
Gemin5 A T 11: 58,156,628 probably null Het
Gm4736 A T 6: 132,115,677 noncoding transcript Het
Grin2b T C 6: 135,843,110 N368S probably benign Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Htr1f G A 16: 64,925,897 P344L probably damaging Het
Ighv7-3 T A 12: 114,153,299 Y81F probably damaging Het
Jakmip3 C A 7: 139,017,745 probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Khdrbs3 T C 15: 69,049,375 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Myom2 T G 8: 15,085,294 I499S probably benign Het
Nos2 T A 11: 78,959,695 F1126L possibly damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pou6f1 C A 15: 100,580,924 V368L probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rbm45 A G 2: 76,379,018 E392G probably damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Rnf222 G T 11: 68,893,156 R183L probably damaging Het
Robo1 C T 16: 73,035,917 T1526I probably benign Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Slc13a2 A G 11: 78,400,840 F329S probably benign Het
Smc2 T C 4: 52,476,850 probably benign Het
Sycp2 A T 2: 178,401,653 probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tgfbr2 T C 9: 116,129,833 Y146C probably damaging Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Ubn1 A G 16: 5,074,379 probably benign Het
Ubp1 T C 9: 113,951,686 probably null Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Other mutations in Tnfrsf11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Tnfrsf11a APN 1 105809422 missense possibly damaging 0.80
IGL02429:Tnfrsf11a APN 1 105827718 missense probably benign 0.14
IGL03222:Tnfrsf11a APN 1 105821490 missense probably damaging 1.00
IGL03276:Tnfrsf11a APN 1 105821490 missense probably damaging 1.00
PIT4354001:Tnfrsf11a UTSW 1 105821517 missense probably damaging 1.00
R0321:Tnfrsf11a UTSW 1 105844857 nonsense probably null
R0514:Tnfrsf11a UTSW 1 105826992 missense probably damaging 1.00
R0655:Tnfrsf11a UTSW 1 105808155 missense unknown
R1470:Tnfrsf11a UTSW 1 105825048 missense probably damaging 0.96
R1470:Tnfrsf11a UTSW 1 105825048 missense probably damaging 0.96
R1868:Tnfrsf11a UTSW 1 105844705 missense probably damaging 1.00
R2900:Tnfrsf11a UTSW 1 105827061 missense probably benign 0.03
R3816:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3817:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3818:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3819:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3879:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R4037:Tnfrsf11a UTSW 1 105827739 splice site probably null
R4039:Tnfrsf11a UTSW 1 105827739 splice site probably null
R4238:Tnfrsf11a UTSW 1 105827237 missense probably damaging 1.00
R5708:Tnfrsf11a UTSW 1 105813820 intron probably null
R6102:Tnfrsf11a UTSW 1 105819946 missense possibly damaging 0.62
R6910:Tnfrsf11a UTSW 1 105844546 missense probably damaging 1.00
R7169:Tnfrsf11a UTSW 1 105844695 missense possibly damaging 0.95
R7178:Tnfrsf11a UTSW 1 105827539 missense probably benign 0.04
R7293:Tnfrsf11a UTSW 1 105808141 critical splice acceptor site probably null
R7323:Tnfrsf11a UTSW 1 105844730 missense probably damaging 1.00
R7334:Tnfrsf11a UTSW 1 105827129 missense possibly damaging 0.92
R7607:Tnfrsf11a UTSW 1 105844732 missense probably benign 0.02
R7614:Tnfrsf11a UTSW 1 105827369 missense probably damaging 1.00
R7651:Tnfrsf11a UTSW 1 105809446 missense probably damaging 1.00
R7908:Tnfrsf11a UTSW 1 105809374 missense probably damaging 1.00
R7989:Tnfrsf11a UTSW 1 105809374 missense probably damaging 1.00
Z1177:Tnfrsf11a UTSW 1 105826999
Predicted Primers PCR Primer
(F):5'- GTGAGTCAAATCTATAGGCTGGTG -3'
(R):5'- TTTTAACCTGAGGCACTGGGG -3'

Sequencing Primer
(F):5'- CAAATCTATAGGCTGGTGTTCATTTC -3'
(R):5'- CTGAGGCACTGGGGACATAAAAC -3'
Posted On2015-02-18