Incidental Mutation 'R3418:Rbm45'
ID266879
Institutional Source Beutler Lab
Gene Symbol Rbm45
Ensembl Gene ENSMUSG00000042369
Gene NameRNA binding motif protein 45
SynonymsG430095G15Rik, Drbp1, Drb1
MMRRC Submission 040636-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R3418 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location76369984-76383768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76379018 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 392 (E392G)
Ref Sequence ENSEMBL: ENSMUSP00000040420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046389]
Predicted Effect probably damaging
Transcript: ENSMUST00000046389
AA Change: E392G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040420
Gene: ENSMUSG00000042369
AA Change: E392G

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
RRM 27 102 2.08e-12 SMART
RRM 122 191 1.37e-12 SMART
RRM 249 320 2.27e-1 SMART
RRM 394 460 4.07e-6 SMART
Meta Mutation Damage Score 0.3954 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RNA recognition motif (RRM)-type RNA-binding family of proteins. This protein exhibits preferential binding to poly(C) RNA. Initial cloning of this gene found that the rat ortholog was dynamically expressed in the developing rat brain. This protein has been localized to inclusion bodies in the brain and spinal cord of amyotrophic lateral sclerosis and Alzheimer's patients. A pseudogene has been identified on chromosome 8. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Acaa1a A G 9: 119,349,490 probably null Het
Agbl5 T C 5: 30,904,723 S756P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Cdc16 C T 8: 13,769,489 Q362* probably null Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Cep170b C T 12: 112,738,468 Q887* probably null Het
Chd9 T C 8: 91,036,591 I2348T probably damaging Het
Clec9a A G 6: 129,421,038 probably benign Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
D130040H23Rik T C 8: 69,302,927 I328T probably benign Het
Dido1 G T 2: 180,660,935 D1725E possibly damaging Het
Dnajb14 A G 3: 137,892,870 D123G probably null Het
Dock2 A T 11: 34,689,760 M661K probably damaging Het
Esam C T 9: 37,537,130 probably null Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fat2 G T 11: 55,278,998 H2978Q probably benign Het
Fbn1 T C 2: 125,320,926 T2147A possibly damaging Het
Fdft1 T C 14: 63,156,621 T214A probably damaging Het
Fhl5 T C 4: 25,211,252 S147G probably benign Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gcat A T 15: 79,042,097 T56S possibly damaging Het
Gemin5 A T 11: 58,156,628 probably null Het
Gm4736 A T 6: 132,115,677 noncoding transcript Het
Grin2b T C 6: 135,843,110 N368S probably benign Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Htr1f G A 16: 64,925,897 P344L probably damaging Het
Ighv7-3 T A 12: 114,153,299 Y81F probably damaging Het
Jakmip3 C A 7: 139,017,745 probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Khdrbs3 T C 15: 69,049,375 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Myom2 T G 8: 15,085,294 I499S probably benign Het
Nos2 T A 11: 78,959,695 F1126L possibly damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pou6f1 C A 15: 100,580,924 V368L probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Rnf222 G T 11: 68,893,156 R183L probably damaging Het
Robo1 C T 16: 73,035,917 T1526I probably benign Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Slc13a2 A G 11: 78,400,840 F329S probably benign Het
Smc2 T C 4: 52,476,850 probably benign Het
Sycp2 A T 2: 178,401,653 probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tgfbr2 T C 9: 116,129,833 Y146C probably damaging Het
Tnfrsf11a A G 1: 105,809,405 D79G possibly damaging Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Ubn1 A G 16: 5,074,379 probably benign Het
Ubp1 T C 9: 113,951,686 probably null Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Other mutations in Rbm45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Rbm45 APN 2 76378707 missense probably damaging 1.00
IGL03335:Rbm45 APN 2 76376433 missense probably damaging 1.00
R0008:Rbm45 UTSW 2 76378398 missense probably damaging 1.00
R0008:Rbm45 UTSW 2 76378398 missense probably damaging 1.00
R0382:Rbm45 UTSW 2 76370211 missense possibly damaging 0.92
R1468:Rbm45 UTSW 2 76372115 missense probably damaging 1.00
R1468:Rbm45 UTSW 2 76372115 missense probably damaging 1.00
R1533:Rbm45 UTSW 2 76372159 critical splice donor site probably null
R1942:Rbm45 UTSW 2 76375479 critical splice donor site probably null
R2046:Rbm45 UTSW 2 76375398 missense probably benign
R2912:Rbm45 UTSW 2 76375454 missense probably benign 0.05
R2913:Rbm45 UTSW 2 76375454 missense probably benign 0.05
R2929:Rbm45 UTSW 2 76378419 missense probably benign 0.00
R3886:Rbm45 UTSW 2 76375424 missense probably benign
R3887:Rbm45 UTSW 2 76375424 missense probably benign
R3888:Rbm45 UTSW 2 76375424 missense probably benign
R4488:Rbm45 UTSW 2 76376396 missense probably damaging 0.99
R5369:Rbm45 UTSW 2 76370250 missense probably damaging 1.00
R5990:Rbm45 UTSW 2 76370412 missense probably benign 0.36
R6569:Rbm45 UTSW 2 76379072 missense probably damaging 1.00
R6806:Rbm45 UTSW 2 76380460 missense probably benign 0.19
R7022:Rbm45 UTSW 2 76376394 missense probably damaging 1.00
R7832:Rbm45 UTSW 2 76376453 missense possibly damaging 0.80
R8720:Rbm45 UTSW 2 76380367 missense probably damaging 1.00
R8933:Rbm45 UTSW 2 76378724 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCGAGAACACTTTCAGAGC -3'
(R):5'- TAGAACTCAGAGCAGGTCACG -3'

Sequencing Primer
(F):5'- TACCGAGAACACTTTCAGAGCTGTAG -3'
(R):5'- AGCAGGTCACGGCGCAG -3'
Posted On2015-02-18