Incidental Mutation 'R3418:Serpini1'
ID266885
Institutional Source Beutler Lab
Gene Symbol Serpini1
Ensembl Gene ENSMUSG00000027834
Gene Nameserine (or cysteine) peptidase inhibitor, clade I, member 1
SynonymsNeuroserpin, Spi17, Ns, PI12
MMRRC Submission 040636-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R3418 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location75557547-75643495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75640282 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 367 (Y367C)
Ref Sequence ENSEMBL: ENSMUSP00000029423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029423]
PDB Structure Crystal Structure of Mouse Neuroserpin (Cleaved form) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000029423
AA Change: Y367C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029423
Gene: ENSMUSG00000027834
AA Change: Y367C

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
SERPIN 31 397 1.46e-158 SMART
Meta Mutation Damage Score 0.1722 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The protein is primarily secreted by axons in the brain, and preferentially reacts with and inhibits tissue-type plasminogen activator. It is thought to play a role in the regulation of axonal growth and the development of synaptic plasticity. Mutations in this gene result in familial encephalopathy with neuroserpin inclusion bodies (FENIB), which is a dominantly inherited form of familial encephalopathy and epilepsy characterized by the accumulation of mutant neuroserpin polymers. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene show no change in brain morphology or histology. However, they show an increase avoidance of novel stimuli and increased anxiety responses in some situations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Acaa1a A G 9: 119,349,490 probably null Het
Agbl5 T C 5: 30,904,723 S756P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Cdc16 C T 8: 13,769,489 Q362* probably null Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Cep170b C T 12: 112,738,468 Q887* probably null Het
Chd9 T C 8: 91,036,591 I2348T probably damaging Het
Clec9a A G 6: 129,421,038 probably benign Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
D130040H23Rik T C 8: 69,302,927 I328T probably benign Het
Dido1 G T 2: 180,660,935 D1725E possibly damaging Het
Dnajb14 A G 3: 137,892,870 D123G probably null Het
Dock2 A T 11: 34,689,760 M661K probably damaging Het
Esam C T 9: 37,537,130 probably null Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fat2 G T 11: 55,278,998 H2978Q probably benign Het
Fbn1 T C 2: 125,320,926 T2147A possibly damaging Het
Fdft1 T C 14: 63,156,621 T214A probably damaging Het
Fhl5 T C 4: 25,211,252 S147G probably benign Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gcat A T 15: 79,042,097 T56S possibly damaging Het
Gemin5 A T 11: 58,156,628 probably null Het
Gm4736 A T 6: 132,115,677 noncoding transcript Het
Grin2b T C 6: 135,843,110 N368S probably benign Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Htr1f G A 16: 64,925,897 P344L probably damaging Het
Ighv7-3 T A 12: 114,153,299 Y81F probably damaging Het
Jakmip3 C A 7: 139,017,745 probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Khdrbs3 T C 15: 69,049,375 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Myom2 T G 8: 15,085,294 I499S probably benign Het
Nos2 T A 11: 78,959,695 F1126L possibly damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pou6f1 C A 15: 100,580,924 V368L probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rbm45 A G 2: 76,379,018 E392G probably damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Rnf222 G T 11: 68,893,156 R183L probably damaging Het
Robo1 C T 16: 73,035,917 T1526I probably benign Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Slc13a2 A G 11: 78,400,840 F329S probably benign Het
Smc2 T C 4: 52,476,850 probably benign Het
Sycp2 A T 2: 178,401,653 probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tgfbr2 T C 9: 116,129,833 Y146C probably damaging Het
Tnfrsf11a A G 1: 105,809,405 D79G possibly damaging Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Ubn1 A G 16: 5,074,379 probably benign Het
Ubp1 T C 9: 113,951,686 probably null Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Other mutations in Serpini1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Serpini1 APN 3 75640695 nonsense probably null
IGL02131:Serpini1 APN 3 75640704 missense probably benign 0.15
IGL02265:Serpini1 APN 3 75619269 missense probably damaging 0.96
IGL03151:Serpini1 APN 3 75613296 missense probably benign 0.00
IGL03232:Serpini1 APN 3 75638010 splice site probably benign
IGL03256:Serpini1 APN 3 75619174 missense probably benign 0.04
R0021:Serpini1 UTSW 3 75619313 missense probably damaging 1.00
R0021:Serpini1 UTSW 3 75619313 missense probably damaging 1.00
R0449:Serpini1 UTSW 3 75613341 missense probably benign 0.06
R0941:Serpini1 UTSW 3 75616627 missense probably damaging 0.97
R1641:Serpini1 UTSW 3 75614670 missense possibly damaging 0.94
R1968:Serpini1 UTSW 3 75614478 missense probably benign 0.34
R1993:Serpini1 UTSW 3 75614664 missense probably damaging 1.00
R2159:Serpini1 UTSW 3 75623944 missense probably benign 0.06
R3419:Serpini1 UTSW 3 75640282 missense probably damaging 1.00
R3780:Serpini1 UTSW 3 75614635 missense probably damaging 0.96
R4618:Serpini1 UTSW 3 75616576 missense probably benign 0.29
R4864:Serpini1 UTSW 3 75613174 missense probably benign 0.01
R4989:Serpini1 UTSW 3 75614488 missense probably benign 0.07
R5080:Serpini1 UTSW 3 75616660 missense probably damaging 1.00
R5324:Serpini1 UTSW 3 75640294 missense probably damaging 1.00
R5767:Serpini1 UTSW 3 75613081 splice site probably benign
R5817:Serpini1 UTSW 3 75613324 missense probably benign 0.07
R5912:Serpini1 UTSW 3 75616607 missense probably benign 0.04
R5944:Serpini1 UTSW 3 75640299 missense probably damaging 1.00
R6704:Serpini1 UTSW 3 75637948 missense probably damaging 0.96
R7716:Serpini1 UTSW 3 75616714 missense probably damaging 1.00
R8696:Serpini1 UTSW 3 75613237 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACATTTCTTCCTTAAAACCCCTG -3'
(R):5'- TGAGACCTATATTTCCTGGAAGCAATG -3'

Sequencing Primer
(F):5'- CTTAAAACCCCTGCTTTCTGC -3'
(R):5'- TTCCTGGAAGCAATGTTTGGAAAAG -3'
Posted On2015-02-18