Mutagenetix > Incidental Mutations

Incidental Mutation 'R3418:Smc2'

266890

Institutional Source

Beutler Lab

Gene Symbol

Smc2

Ensembl Gene

ENSMUSG00000028312

Gene Name

structural maintenance of chromosomes 2

Synonyms

CAP-E, Fin16, 5730502P04Rik, Smc2l1

MMRRC Submission

040636-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R3418 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52439243-52488260 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 52476850 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113940 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102915] [ENSMUST00000117280]

Predicted Effect

probably benign
Transcript: ENSMUST00000102915

SMART Domains

Protein: ENSMUSP00000099979
Gene: ENSMUSG00000028312

Domain	Start	End	E-Value	Type
internal_repeat_1	146	174	2.4e-6	PROSPERO
low complexity region	183	207	N/A	INTRINSIC
coiled coil region	238	355	N/A	INTRINSIC
coiled coil region	400	503	N/A	INTRINSIC
SMC_hinge	520	640	3.8e-34	SMART
coiled coil region	676	880	N/A	INTRINSIC
coiled coil region	984	1031	N/A	INTRINSIC
PDB:4I99\|B	1034	1186	3e-15	PDB
SCOP:d1e69a_	1066	1144	2e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117280

SMART Domains

Protein: ENSMUSP00000113940
Gene: ENSMUSG00000028312

Domain	Start	End	E-Value	Type
Pfam:AAA_21	27	131	3.8e-6	PFAM
internal_repeat_1	146	174	2.4e-6	PROSPERO
low complexity region	183	207	N/A	INTRINSIC
coiled coil region	238	355	N/A	INTRINSIC
coiled coil region	400	503	N/A	INTRINSIC
SMC_hinge	520	640	3.8e-34	SMART
coiled coil region	676	880	N/A	INTRINSIC
coiled coil region	984	1031	N/A	INTRINSIC
PDB:4I99\|B	1034	1186	3e-15	PDB
SCOP:d1e69a_	1066	1144	2e-7	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.6%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a component of both condensin I and condensin II complexes, and forms a heterodimer with structural maintenance of chromosome 4 (Smc4). This heterodimer is the catalytic subunit for both condensin complexes, and is involved in several processes, including chromosome condensation during mitosis and meiosis, cohesin removal during mitosis and meiosis, and single-strand break (SSB) repair. Reduced expression of this gene results in chromosome segregation defects during mitosis and meiosis, with a more severe defect observed in embryonic stem cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice die embryonically. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5530400C23Rik	A	G	6: 133,294,119	Q42R	probably benign	Het
Acaa1a	A	G	9: 119,349,490		probably null	Het
Agbl5	T	C	5: 30,904,723	S756P	probably damaging	Het
Armc9	T	C	1: 86,194,338	L395P	probably damaging	Het
Cdc16	C	T	8: 13,769,489	Q362*	probably null	Het
Cdh5	C	T	8: 104,129,370	R312C	probably damaging	Het
Cep170b	C	T	12: 112,738,468	Q887*	probably null	Het
Chd9	T	C	8: 91,036,591	I2348T	probably damaging	Het
Clec9a	A	G	6: 129,421,038		probably benign	Het
Col6a3	T	C	1: 90,804,091	D873G	probably benign	Het
D130040H23Rik	T	C	8: 69,302,927	I328T	probably benign	Het
Dido1	G	T	2: 180,660,935	D1725E	possibly damaging	Het
Dnajb14	A	G	3: 137,892,870	D123G	probably null	Het
Dock2	A	T	11: 34,689,760	M661K	probably damaging	Het
Esam	C	T	9: 37,537,130		probably null	Het
Fam20c	A	T	5: 138,757,868	N220Y	probably damaging	Het
Fat2	G	T	11: 55,278,998	H2978Q	probably benign	Het
Fbn1	T	C	2: 125,320,926	T2147A	possibly damaging	Het
Fdft1	T	C	14: 63,156,621	T214A	probably damaging	Het
Fhl5	T	C	4: 25,211,252	S147G	probably benign	Het
Flrt2	A	G	12: 95,780,604	Y572C	probably damaging	Het
Gcat	A	T	15: 79,042,097	T56S	possibly damaging	Het
Gemin5	A	T	11: 58,156,628		probably null	Het
Gm4736	A	T	6: 132,115,677		noncoding transcript	Het
Grin2b	T	C	6: 135,843,110	N368S	probably benign	Het
Gsto1	T	C	19: 47,857,905	F64L	probably benign	Het
Gucy1a1	A	G	3: 82,106,133	S401P	probably damaging	Het
Htr1f	G	A	16: 64,925,897	P344L	probably damaging	Het
Ighv7-3	T	A	12: 114,153,299	Y81F	probably damaging	Het
Jakmip3	C	A	7: 139,017,745		probably benign	Het
Kcnj13	T	C	1: 87,386,919	T194A	probably benign	Het
Khdrbs3	T	C	15: 69,049,375		probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lyn	A	T	4: 3,746,833	I204F	probably damaging	Het
Mbd6	C	G	10: 127,286,503	R152P	probably null	Het
Myof	A	G	19: 37,922,978	S1502P	probably damaging	Het
Myom2	T	G	8: 15,085,294	I499S	probably benign	Het
Nos2	T	A	11: 78,959,695	F1126L	possibly damaging	Het
Olfr399	G	A	11: 74,053,988	T257I	probably damaging	Het
P2ry1	T	C	3: 61,003,712	F91L	probably damaging	Het
Pcdh15	C	A	10: 74,584,222	D1166E	probably benign	Het
Pou6f1	C	A	15: 100,580,924	V368L	probably benign	Het
Ptcd3	A	T	6: 71,883,486	I579K	possibly damaging	Het
Rbm45	A	G	2: 76,379,018	E392G	probably damaging	Het
Rnf168	A	G	16: 32,299,192	N524D	probably benign	Het
Rnf222	G	T	11: 68,893,156	R183L	probably damaging	Het
Robo1	C	T	16: 73,035,917	T1526I	probably benign	Het
Sel1l	A	G	12: 91,810,002	W689R	probably damaging	Het
Serpinb13	T	C	1: 106,998,927	S218P	probably damaging	Het
Serpini1	A	G	3: 75,640,282	Y367C	probably damaging	Het
Slc13a2	A	G	11: 78,400,840	F329S	probably benign	Het
Sycp2	A	T	2: 178,401,653		probably benign	Het
Tab2	G	A	10: 7,907,481	P679L	probably damaging	Het
Tdrd1	T	A	19: 56,831,231	N54K	possibly damaging	Het
Tgfbr2	T	C	9: 116,129,833	Y146C	probably damaging	Het
Tnfrsf11a	A	G	1: 105,809,405	D79G	possibly damaging	Het
Trpa1	T	C	1: 14,874,381	I1046M	probably benign	Het
Ubn1	A	G	16: 5,074,379		probably benign	Het
Ubp1	T	C	9: 113,951,686		probably null	Het
Vmn2r2	A	T	3: 64,116,899	F754I	probably benign	Het

Other mutations in Smc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01322:Smc2	APN	4	52450842	missense	probably damaging	1.00
IGL02045:Smc2	APN	4	52462914	missense	probably benign	0.01
IGL03013:Smc2	APN	4	52442280	missense	probably damaging	1.00
IGL03031:Smc2	APN	4	52449638	missense	probably benign	0.35
IGL03246:Smc2	APN	4	52440301	nonsense	probably null
R0539:Smc2	UTSW	4	52458558	missense	probably benign	0.01
R0782:Smc2	UTSW	4	52469799	missense	probably benign	0.30
R1908:Smc2	UTSW	4	52450863	missense	probably damaging	0.97
R2054:Smc2	UTSW	4	52462948	missense	probably benign	0.00
R2109:Smc2	UTSW	4	52474987	missense	probably benign	0.00
R2318:Smc2	UTSW	4	52446030	missense	probably damaging	1.00
R2352:Smc2	UTSW	4	52460266	missense	probably benign
R4003:Smc2	UTSW	4	52462897	missense	probably damaging	1.00
R4133:Smc2	UTSW	4	52450947	missense	probably damaging	0.99
R4299:Smc2	UTSW	4	52440238	utr 5 prime	probably benign
R4547:Smc2	UTSW	4	52467866	missense	probably benign	0.09
R4787:Smc2	UTSW	4	52462927	missense	probably damaging	0.98
R4816:Smc2	UTSW	4	52451231	missense	probably benign	0.00
R4829:Smc2	UTSW	4	52449612	missense	probably damaging	0.98
R4861:Smc2	UTSW	4	52461090	missense	probably benign	0.14
R4861:Smc2	UTSW	4	52461090	missense	probably benign	0.14
R4951:Smc2	UTSW	4	52462926	missense	possibly damaging	0.95
R4963:Smc2	UTSW	4	52450826	missense	probably damaging	1.00
R4996:Smc2	UTSW	4	52461042	splice site	probably null
R5028:Smc2	UTSW	4	52458447	missense	probably damaging	0.96
R5103:Smc2	UTSW	4	52459033	missense	probably damaging	1.00
R5159:Smc2	UTSW	4	52460181	missense	possibly damaging	0.65
R5387:Smc2	UTSW	4	52475096	missense	probably benign	0.16
R5697:Smc2	UTSW	4	52459045	missense	probably benign	0.01
R6006:Smc2	UTSW	4	52459024	missense	probably benign
R6246:Smc2	UTSW	4	52460289	missense	probably damaging	1.00
R6321:Smc2	UTSW	4	52462814	missense	probably benign
R6590:Smc2	UTSW	4	52449375	missense	probably benign	0.01
R6658:Smc2	UTSW	4	52451322	missense	probably benign	0.21
R6690:Smc2	UTSW	4	52449375	missense	probably benign	0.01
R7422:Smc2	UTSW	4	52440301	missense	probably benign	0.02
R7486:Smc2	UTSW	4	52462861	missense	possibly damaging	0.54
R7487:Smc2	UTSW	4	52478448	missense	probably damaging	1.00
R7532:Smc2	UTSW	4	52451013	missense	probably damaging	1.00
R7556:Smc2	UTSW	4	52457379	missense	probably benign	0.03
R7912:Smc2	UTSW	4	52450854	missense	probably benign	0.00
R7993:Smc2	UTSW	4	52450854	missense	probably benign	0.00
RF006:Smc2	UTSW	4	52442276	missense	probably benign	0.03
X0065:Smc2	UTSW	4	52440370	missense	probably damaging	1.00
Z1176:Smc2	UTSW	4	52481682	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCCAGGTATCCAAAATGTTAAG -3'
(R):5'- TCAGCAGATAACAAAAGTCATGGATAC -3'

Sequencing Primer
(F):5'- GATTGGATTAATGCTGAGAAACACC -3'
(R):5'- TACAAGACAGCATAAAGGGAACTG -3'

Posted On

2015-02-18