Incidental Mutation 'R3418:Agbl5'
ID266891
Institutional Source Beutler Lab
Gene Symbol Agbl5
Ensembl Gene ENSMUSG00000029165
Gene NameATP/GTP binding protein-like 5
Synonyms
MMRRC Submission 040636-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3418 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30888694-30906965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30904723 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 756 (S756P)
Ref Sequence ENSEMBL: ENSMUSP00000144188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114700] [ENSMUST00000132034] [ENSMUST00000132253] [ENSMUST00000201168] [ENSMUST00000201225] [ENSMUST00000201817] [ENSMUST00000201917] [ENSMUST00000202060] [ENSMUST00000202109]
Predicted Effect probably damaging
Transcript: ENSMUST00000114700
AA Change: S785P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110348
Gene: ENSMUSG00000029165
AA Change: S785P

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 220 390 1.1e-18 PFAM
low complexity region 413 428 N/A INTRINSIC
Blast:Zn_pept 453 518 5e-14 BLAST
low complexity region 567 577 N/A INTRINSIC
low complexity region 672 683 N/A INTRINSIC
low complexity region 743 762 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114704
AA Change: S756P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110352
Gene: ENSMUSG00000029165
AA Change: S756P

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 370 7.3e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 836 847 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132034
Predicted Effect probably benign
Transcript: ENSMUST00000132253
SMART Domains Protein: ENSMUSP00000128352
Gene: ENSMUSG00000038803

DomainStartEndE-ValueType
Pfam:Ost4 1 35 3.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201014
AA Change: S75P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably damaging
Transcript: ENSMUST00000201168
AA Change: S756P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143808
Gene: ENSMUSG00000029165
AA Change: S756P

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 370 7.3e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 836 847 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201225
SMART Domains Protein: ENSMUSP00000143934
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201817
AA Change: S756P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144304
Gene: ENSMUSG00000029165
AA Change: S756P

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.4e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201917
AA Change: S756P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144188
Gene: ENSMUSG00000029165
AA Change: S756P

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.5e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202060
SMART Domains Protein: ENSMUSP00000144018
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202109
AA Change: S198P

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202757
Meta Mutation Damage Score 0.0714 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metallocarboxypeptidase involved in protein deglutamylation and a member of the peptidase M14 family of proteins. The encoded protein has been described as a "dual-functional" deglutamylase that can remove glutamate residues from both carboxyl termini and side chains of protein substrates. This deglutamylase activity may be important in antiviral immunity. Mutations in this gene are associated with retinitis pigmentosa. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to HSV or VACV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Acaa1a A G 9: 119,349,490 probably null Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Cdc16 C T 8: 13,769,489 Q362* probably null Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Cep170b C T 12: 112,738,468 Q887* probably null Het
Chd9 T C 8: 91,036,591 I2348T probably damaging Het
Clec9a A G 6: 129,421,038 probably benign Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
D130040H23Rik T C 8: 69,302,927 I328T probably benign Het
Dido1 G T 2: 180,660,935 D1725E possibly damaging Het
Dnajb14 A G 3: 137,892,870 D123G probably null Het
Dock2 A T 11: 34,689,760 M661K probably damaging Het
Esam C T 9: 37,537,130 probably null Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fat2 G T 11: 55,278,998 H2978Q probably benign Het
Fbn1 T C 2: 125,320,926 T2147A possibly damaging Het
Fdft1 T C 14: 63,156,621 T214A probably damaging Het
Fhl5 T C 4: 25,211,252 S147G probably benign Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gcat A T 15: 79,042,097 T56S possibly damaging Het
Gemin5 A T 11: 58,156,628 probably null Het
Gm4736 A T 6: 132,115,677 noncoding transcript Het
Grin2b T C 6: 135,843,110 N368S probably benign Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Htr1f G A 16: 64,925,897 P344L probably damaging Het
Ighv7-3 T A 12: 114,153,299 Y81F probably damaging Het
Jakmip3 C A 7: 139,017,745 probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Khdrbs3 T C 15: 69,049,375 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Myom2 T G 8: 15,085,294 I499S probably benign Het
Nos2 T A 11: 78,959,695 F1126L possibly damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pou6f1 C A 15: 100,580,924 V368L probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rbm45 A G 2: 76,379,018 E392G probably damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Rnf222 G T 11: 68,893,156 R183L probably damaging Het
Robo1 C T 16: 73,035,917 T1526I probably benign Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Slc13a2 A G 11: 78,400,840 F329S probably benign Het
Smc2 T C 4: 52,476,850 probably benign Het
Sycp2 A T 2: 178,401,653 probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tgfbr2 T C 9: 116,129,833 Y146C probably damaging Het
Tnfrsf11a A G 1: 105,809,405 D79G possibly damaging Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Ubn1 A G 16: 5,074,379 probably benign Het
Ubp1 T C 9: 113,951,686 probably null Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Other mutations in Agbl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Agbl5 APN 5 30893234 missense probably benign 0.00
sausage UTSW 5 30894358 nonsense probably null
R0355:Agbl5 UTSW 5 30891991 critical splice donor site probably null
R0575:Agbl5 UTSW 5 30894454 missense probably damaging 1.00
R1694:Agbl5 UTSW 5 30893382 missense probably damaging 1.00
R1709:Agbl5 UTSW 5 30906241 missense probably damaging 1.00
R1829:Agbl5 UTSW 5 30903064 missense possibly damaging 0.66
R2434:Agbl5 UTSW 5 30894013 missense probably damaging 0.97
R4827:Agbl5 UTSW 5 30895814 missense probably damaging 1.00
R4828:Agbl5 UTSW 5 30890715 missense probably damaging 1.00
R4830:Agbl5 UTSW 5 30890715 missense probably damaging 1.00
R5017:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5018:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5036:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5038:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5052:Agbl5 UTSW 5 30891214 missense possibly damaging 0.76
R5071:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5073:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5074:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5081:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5083:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5103:Agbl5 UTSW 5 30894001 missense probably damaging 1.00
R5107:Agbl5 UTSW 5 30892478 missense probably damaging 1.00
R5130:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5395:Agbl5 UTSW 5 30890338 missense probably damaging 1.00
R5522:Agbl5 UTSW 5 30893903 unclassified probably null
R5524:Agbl5 UTSW 5 30893903 unclassified probably null
R5526:Agbl5 UTSW 5 30893903 unclassified probably null
R5657:Agbl5 UTSW 5 30894046 missense probably damaging 1.00
R5790:Agbl5 UTSW 5 30894358 nonsense probably null
R6301:Agbl5 UTSW 5 30891833 missense probably damaging 1.00
R6891:Agbl5 UTSW 5 30895178 missense probably damaging 1.00
R6919:Agbl5 UTSW 5 30904717 missense probably benign 0.13
R7388:Agbl5 UTSW 5 30903239 nonsense probably null
R7392:Agbl5 UTSW 5 30890771 critical splice donor site probably null
R7410:Agbl5 UTSW 5 30890688 missense possibly damaging 0.94
R7452:Agbl5 UTSW 5 30893391 missense probably damaging 1.00
R8312:Agbl5 UTSW 5 30894506 missense probably damaging 1.00
RF007:Agbl5 UTSW 5 30903245 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCACTAAACACCCTGCATG -3'
(R):5'- ATCAGGAAGGAGCATTCCCC -3'

Sequencing Primer
(F):5'- TCAAGGGCTACTGATAGAGCTC -3'
(R):5'- GGAAGGAGCATTCCCCTACCC -3'
Posted On2015-02-18