Incidental Mutation 'R3418:Fam20c'
ID266892
Institutional Source Beutler Lab
Gene Symbol Fam20c
Ensembl Gene ENSMUSG00000025854
Gene Namefamily with sequence similarity 20, member C
SynonymsDMP4
MMRRC Submission 040636-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.366) question?
Stock #R3418 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location138754514-138810077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138757868 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 220 (N220Y)
Ref Sequence ENSEMBL: ENSMUSP00000026972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026972] [ENSMUST00000160645]
Predicted Effect probably damaging
Transcript: ENSMUST00000026972
AA Change: N220Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026972
Gene: ENSMUSG00000025854
AA Change: N220Y

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 49 63 N/A INTRINSIC
low complexity region 132 156 N/A INTRINSIC
Pfam:Fam20C 349 565 4.5e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160645
SMART Domains Protein: ENSMUSP00000124584
Gene: ENSMUSG00000025854

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 49 63 N/A INTRINSIC
low complexity region 132 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197027
Meta Mutation Damage Score 0.2778 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of secreted protein kinases. The encoded protein binds calcium and phosphorylates proteins involved in bone mineralization. Mutations in this gene are associated with the autosomal recessive disorder Raine syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice with global conditional deletion of this gene display infertility, dwarfism, delayed bone ossification, reduced bone mineralization, fragile skeletons, hypophosphatemic rickets, and impaired osteoblast differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Acaa1a A G 9: 119,349,490 probably null Het
Agbl5 T C 5: 30,904,723 S756P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Cdc16 C T 8: 13,769,489 Q362* probably null Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Cep170b C T 12: 112,738,468 Q887* probably null Het
Chd9 T C 8: 91,036,591 I2348T probably damaging Het
Clec9a A G 6: 129,421,038 probably benign Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
D130040H23Rik T C 8: 69,302,927 I328T probably benign Het
Dido1 G T 2: 180,660,935 D1725E possibly damaging Het
Dnajb14 A G 3: 137,892,870 D123G probably null Het
Dock2 A T 11: 34,689,760 M661K probably damaging Het
Esam C T 9: 37,537,130 probably null Het
Fat2 G T 11: 55,278,998 H2978Q probably benign Het
Fbn1 T C 2: 125,320,926 T2147A possibly damaging Het
Fdft1 T C 14: 63,156,621 T214A probably damaging Het
Fhl5 T C 4: 25,211,252 S147G probably benign Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gcat A T 15: 79,042,097 T56S possibly damaging Het
Gemin5 A T 11: 58,156,628 probably null Het
Gm4736 A T 6: 132,115,677 noncoding transcript Het
Grin2b T C 6: 135,843,110 N368S probably benign Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Htr1f G A 16: 64,925,897 P344L probably damaging Het
Ighv7-3 T A 12: 114,153,299 Y81F probably damaging Het
Jakmip3 C A 7: 139,017,745 probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Khdrbs3 T C 15: 69,049,375 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Myom2 T G 8: 15,085,294 I499S probably benign Het
Nos2 T A 11: 78,959,695 F1126L possibly damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pou6f1 C A 15: 100,580,924 V368L probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rbm45 A G 2: 76,379,018 E392G probably damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Rnf222 G T 11: 68,893,156 R183L probably damaging Het
Robo1 C T 16: 73,035,917 T1526I probably benign Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Slc13a2 A G 11: 78,400,840 F329S probably benign Het
Smc2 T C 4: 52,476,850 probably benign Het
Sycp2 A T 2: 178,401,653 probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tgfbr2 T C 9: 116,129,833 Y146C probably damaging Het
Tnfrsf11a A G 1: 105,809,405 D79G possibly damaging Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Ubn1 A G 16: 5,074,379 probably benign Het
Ubp1 T C 9: 113,951,686 probably null Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Other mutations in Fam20c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Fam20c APN 5 138809157 missense probably benign
IGL01096:Fam20c APN 5 138809155 missense possibly damaging 0.93
IGL01393:Fam20c APN 5 138807271 missense probably damaging 1.00
IGL01576:Fam20c APN 5 138807339 missense probably damaging 0.98
IGL01960:Fam20c APN 5 138806320 missense probably damaging 0.99
IGL02317:Fam20c APN 5 138806360 missense probably damaging 1.00
IGL02979:Fam20c APN 5 138757865 missense probably damaging 1.00
IGL02988:Fam20c UTSW 5 138755994 missense probably benign 0.20
R0197:Fam20c UTSW 5 138755724 missense probably damaging 1.00
R0594:Fam20c UTSW 5 138766637 missense possibly damaging 0.94
R0615:Fam20c UTSW 5 138807486 missense probably damaging 0.99
R1672:Fam20c UTSW 5 138807301 missense probably damaging 1.00
R2044:Fam20c UTSW 5 138756227 critical splice donor site probably null
R2484:Fam20c UTSW 5 138809117 missense probably benign
R3419:Fam20c UTSW 5 138757868 missense probably damaging 0.99
R4205:Fam20c UTSW 5 138755676 missense probably damaging 1.00
R5966:Fam20c UTSW 5 138756177 missense probably damaging 1.00
R6346:Fam20c UTSW 5 138766695 missense probably damaging 1.00
R7290:Fam20c UTSW 5 138807554 missense probably damaging 1.00
R7559:Fam20c UTSW 5 138793199 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCGAACCTGTACTTTGAACTC -3'
(R):5'- AAAGTGTGGCTCCCTGCATAG -3'

Sequencing Primer
(F):5'- TTTGAACTCAAAGTCCCAAGCC -3'
(R):5'- GGAGGCTAACTTCACACAGTCCTG -3'
Posted On2015-02-18