Mutagenetix > Incidental Mutation

Incidental Mutation 'R3418:Grin2b'

266897

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

040636-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3418 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135843110 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 368 (N368S)

Ref Sequence

ENSEMBL: ENSMUSP00000107536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053880
AA Change: N368S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: N368S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111905
AA Change: N368S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: N368S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Meta Mutation Damage Score

0.0752

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.6%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5530400C23Rik	A	G	6: 133,294,119	Q42R	probably benign	Het
Acaa1a	A	G	9: 119,349,490		probably null	Het
Agbl5	T	C	5: 30,904,723	S756P	probably damaging	Het
Armc9	T	C	1: 86,194,338	L395P	probably damaging	Het
Cdc16	C	T	8: 13,769,489	Q362*	probably null	Het
Cdh5	C	T	8: 104,129,370	R312C	probably damaging	Het
Cep170b	C	T	12: 112,738,468	Q887*	probably null	Het
Chd9	T	C	8: 91,036,591	I2348T	probably damaging	Het
Clec9a	A	G	6: 129,421,038		probably benign	Het
Col6a3	T	C	1: 90,804,091	D873G	probably benign	Het
D130040H23Rik	T	C	8: 69,302,927	I328T	probably benign	Het
Dido1	G	T	2: 180,660,935	D1725E	possibly damaging	Het
Dnajb14	A	G	3: 137,892,870	D123G	probably null	Het
Dock2	A	T	11: 34,689,760	M661K	probably damaging	Het
Esam	C	T	9: 37,537,130		probably null	Het
Fam20c	A	T	5: 138,757,868	N220Y	probably damaging	Het
Fat2	G	T	11: 55,278,998	H2978Q	probably benign	Het
Fbn1	T	C	2: 125,320,926	T2147A	possibly damaging	Het
Fdft1	T	C	14: 63,156,621	T214A	probably damaging	Het
Fhl5	T	C	4: 25,211,252	S147G	probably benign	Het
Flrt2	A	G	12: 95,780,604	Y572C	probably damaging	Het
Gcat	A	T	15: 79,042,097	T56S	possibly damaging	Het
Gemin5	A	T	11: 58,156,628		probably null	Het
Gm4736	A	T	6: 132,115,677		noncoding transcript	Het
Gsto1	T	C	19: 47,857,905	F64L	probably benign	Het
Gucy1a1	A	G	3: 82,106,133	S401P	probably damaging	Het
Htr1f	G	A	16: 64,925,897	P344L	probably damaging	Het
Ighv7-3	T	A	12: 114,153,299	Y81F	probably damaging	Het
Jakmip3	C	A	7: 139,017,745		probably benign	Het
Kcnj13	T	C	1: 87,386,919	T194A	probably benign	Het
Khdrbs3	T	C	15: 69,049,375		probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lyn	A	T	4: 3,746,833	I204F	probably damaging	Het
Mbd6	C	G	10: 127,286,503	R152P	probably null	Het
Myof	A	G	19: 37,922,978	S1502P	probably damaging	Het
Myom2	T	G	8: 15,085,294	I499S	probably benign	Het
Nos2	T	A	11: 78,959,695	F1126L	possibly damaging	Het
Olfr399	G	A	11: 74,053,988	T257I	probably damaging	Het
P2ry1	T	C	3: 61,003,712	F91L	probably damaging	Het
Pcdh15	C	A	10: 74,584,222	D1166E	probably benign	Het
Pou6f1	C	A	15: 100,580,924	V368L	probably benign	Het
Ptcd3	A	T	6: 71,883,486	I579K	possibly damaging	Het
Rbm45	A	G	2: 76,379,018	E392G	probably damaging	Het
Rnf168	A	G	16: 32,299,192	N524D	probably benign	Het
Rnf222	G	T	11: 68,893,156	R183L	probably damaging	Het
Robo1	C	T	16: 73,035,917	T1526I	probably benign	Het
Sel1l	A	G	12: 91,810,002	W689R	probably damaging	Het
Serpinb13	T	C	1: 106,998,927	S218P	probably damaging	Het
Serpini1	A	G	3: 75,640,282	Y367C	probably damaging	Het
Slc13a2	A	G	11: 78,400,840	F329S	probably benign	Het
Smc2	T	C	4: 52,476,850		probably benign	Het
Sycp2	A	T	2: 178,401,653		probably benign	Het
Tab2	G	A	10: 7,907,481	P679L	probably damaging	Het
Tdrd1	T	A	19: 56,831,231	N54K	possibly damaging	Het
Tgfbr2	T	C	9: 116,129,833	Y146C	probably damaging	Het
Tnfrsf11a	A	G	1: 105,809,405	D79G	possibly damaging	Het
Trpa1	T	C	1: 14,874,381	I1046M	probably benign	Het
Ubn1	A	G	16: 5,074,379		probably benign	Het
Ubp1	T	C	9: 113,951,686		probably null	Het
Vmn2r2	A	T	3: 64,116,899	F754I	probably benign	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135733929	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135732732	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135778700	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135733429	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135778699	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135733407	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135733944	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135740998	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135732551	missense	probably benign
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135780306	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135780251	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135740949	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135923364	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135733488	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135732499	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135923076	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135922969	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135733916	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135922987	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136044009	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135732511	frame shift	probably null
R9076:Grin2b	UTSW	6	135732511	frame shift	probably null
R9172:Grin2b	UTSW	6	135779257	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135733401	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135922870	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTTAGCCCAAGTAGCAAGAGACTG -3'
(R):5'- TTGTCAACCTGAGTGCCCTC -3'

Sequencing Primer
(F):5'- CTGAAAATGAATGCTTGCTTGAGGTC -3'
(R):5'- GAGTGCCCTCTGCTTTCAAG -3'

Posted On

2015-02-18