Incidental Mutation 'R3418:Cdc16'
ID266901
Institutional Source Beutler Lab
Gene Symbol Cdc16
Ensembl Gene ENSMUSG00000038416
Gene NameCDC16 cell division cycle 16
Synonyms2810431D22Rik, 2700071J12Rik
MMRRC Submission 040636-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R3418 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13757676-13781938 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 13769489 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 362 (Q362*)
Ref Sequence ENSEMBL: ENSMUSP00000047950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043962] [ENSMUST00000130173]
Predicted Effect probably null
Transcript: ENSMUST00000043962
AA Change: Q362*
SMART Domains Protein: ENSMUSP00000047950
Gene: ENSMUSG00000038416
AA Change: Q362*

DomainStartEndE-ValueType
Pfam:TPR_9 11 63 1.8e-3 PFAM
Pfam:ANAPC3 15 95 3.5e-23 PFAM
TPR 130 163 1.17e1 SMART
Blast:TPR 299 333 2e-8 BLAST
Blast:TPR 334 367 1e-14 BLAST
TPR 368 401 1.48e1 SMART
Blast:TPR 402 435 7e-15 BLAST
TPR 445 478 6.68e-6 SMART
TPR 479 512 1.74e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130173
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions as a protein ubiquitin ligase and is a component of the multiprotein APC complex. The APC complex is a cyclin degradation system that governs exit from mitosis by targeting cell cycle proteins for degredation by the 26S proteasome. Each component protein of the APC complex is highly conserved among eukaryotic organisms. This protein, and other APC complex proteins, contain a tetratricopeptide repeat (TPR) domain; a protein domain that is often involved in protein-protein interactions and the assembly of multiprotein complexes. Multiple alternatively spliced transcript variants, encoding distinct proteins, have been identified. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Acaa1a A G 9: 119,349,490 probably null Het
Agbl5 T C 5: 30,904,723 S756P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Cep170b C T 12: 112,738,468 Q887* probably null Het
Chd9 T C 8: 91,036,591 I2348T probably damaging Het
Clec9a A G 6: 129,421,038 probably benign Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
D130040H23Rik T C 8: 69,302,927 I328T probably benign Het
Dido1 G T 2: 180,660,935 D1725E possibly damaging Het
Dnajb14 A G 3: 137,892,870 D123G probably null Het
Dock2 A T 11: 34,689,760 M661K probably damaging Het
Esam C T 9: 37,537,130 probably null Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fat2 G T 11: 55,278,998 H2978Q probably benign Het
Fbn1 T C 2: 125,320,926 T2147A possibly damaging Het
Fdft1 T C 14: 63,156,621 T214A probably damaging Het
Fhl5 T C 4: 25,211,252 S147G probably benign Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gcat A T 15: 79,042,097 T56S possibly damaging Het
Gemin5 A T 11: 58,156,628 probably null Het
Gm4736 A T 6: 132,115,677 noncoding transcript Het
Grin2b T C 6: 135,843,110 N368S probably benign Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Htr1f G A 16: 64,925,897 P344L probably damaging Het
Ighv7-3 T A 12: 114,153,299 Y81F probably damaging Het
Jakmip3 C A 7: 139,017,745 probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Khdrbs3 T C 15: 69,049,375 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Myom2 T G 8: 15,085,294 I499S probably benign Het
Nos2 T A 11: 78,959,695 F1126L possibly damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pou6f1 C A 15: 100,580,924 V368L probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rbm45 A G 2: 76,379,018 E392G probably damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Rnf222 G T 11: 68,893,156 R183L probably damaging Het
Robo1 C T 16: 73,035,917 T1526I probably benign Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Slc13a2 A G 11: 78,400,840 F329S probably benign Het
Smc2 T C 4: 52,476,850 probably benign Het
Sycp2 A T 2: 178,401,653 probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tgfbr2 T C 9: 116,129,833 Y146C probably damaging Het
Tnfrsf11a A G 1: 105,809,405 D79G possibly damaging Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Ubn1 A G 16: 5,074,379 probably benign Het
Ubp1 T C 9: 113,951,686 probably null Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Other mutations in Cdc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cdc16 APN 8 13767575 nonsense probably null
IGL01109:Cdc16 APN 8 13764606 missense probably benign 0.00
IGL01475:Cdc16 APN 8 13781542 missense probably benign
IGL02729:Cdc16 APN 8 13779250 missense possibly damaging 0.93
IGL03389:Cdc16 APN 8 13759179 missense probably damaging 1.00
R0026:Cdc16 UTSW 8 13759130 splice site probably null
R0373:Cdc16 UTSW 8 13779264 missense probably benign 0.04
R0520:Cdc16 UTSW 8 13760569 critical splice donor site probably null
R0564:Cdc16 UTSW 8 13781618 missense probably damaging 1.00
R1470:Cdc16 UTSW 8 13758992 splice site probably benign
R1487:Cdc16 UTSW 8 13771445 missense probably benign 0.17
R1753:Cdc16 UTSW 8 13764688 nonsense probably null
R1883:Cdc16 UTSW 8 13775738 missense probably damaging 1.00
R3087:Cdc16 UTSW 8 13759004 missense probably damaging 0.98
R3756:Cdc16 UTSW 8 13777609 critical splice donor site probably null
R4152:Cdc16 UTSW 8 13762857 missense probably damaging 1.00
R4842:Cdc16 UTSW 8 13781644 utr 3 prime probably benign
R5122:Cdc16 UTSW 8 13764570 missense probably damaging 1.00
R5492:Cdc16 UTSW 8 13763915 splice site probably null
R5982:Cdc16 UTSW 8 13781399 missense possibly damaging 0.73
R6145:Cdc16 UTSW 8 13767573 missense possibly damaging 0.96
R6154:Cdc16 UTSW 8 13768609 missense possibly damaging 0.87
R6611:Cdc16 UTSW 8 13781512 missense probably benign
R6992:Cdc16 UTSW 8 13759188 missense probably benign 0.22
R7011:Cdc16 UTSW 8 13769451 missense probably damaging 1.00
R7484:Cdc16 UTSW 8 13777605 missense probably benign 0.01
R7593:Cdc16 UTSW 8 13777605 missense probably benign 0.01
R7946:Cdc16 UTSW 8 13762882 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CCACTTGTGAGCAGTTTACTCAG -3'
(R):5'- GCTGGCTGGAAGAGAATCAC -3'

Sequencing Primer
(F):5'- GATGCCATGTACTTAGACAAACCTAG -3'
(R):5'- GCTGGAAGAGAATCACATCAACCTTG -3'
Posted On2015-02-18