Incidental Mutation 'R3418:Mbd6'
ID266913
Institutional Source Beutler Lab
Gene Symbol Mbd6
Ensembl Gene ENSMUSG00000025409
Gene Namemethyl-CpG binding domain protein 6
SynonymsD10Wsu93e
MMRRC Submission 040636-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3418 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127281956-127289018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 127286503 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 152 (R152P)
Ref Sequence ENSEMBL: ENSMUSP00000112805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026475] [ENSMUST00000026476] [ENSMUST00000026479] [ENSMUST00000119078] [ENSMUST00000139091] [ENSMUST00000156208] [ENSMUST00000172567] [ENSMUST00000230446]
Predicted Effect probably benign
Transcript: ENSMUST00000026475
SMART Domains Protein: ENSMUSP00000026475
Gene: ENSMUSG00000025408

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
BRLZ 94 160 1.23e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000026476
AA Change: R152P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026476
Gene: ENSMUSG00000025409
AA Change: R152P

DomainStartEndE-ValueType
Blast:MBD 26 79 8e-10 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 269 295 N/A INTRINSIC
low complexity region 311 342 N/A INTRINSIC
low complexity region 347 378 N/A INTRINSIC
low complexity region 383 428 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 461 498 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 634 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
low complexity region 653 674 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 733 799 N/A INTRINSIC
low complexity region 815 849 N/A INTRINSIC
low complexity region 853 890 N/A INTRINSIC
low complexity region 949 958 N/A INTRINSIC
low complexity region 978 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026479
SMART Domains Protein: ENSMUSP00000026479
Gene: ENSMUSG00000025410

DomainStartEndE-ValueType
Pfam:Dynamitin 16 400 7.1e-129 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119078
AA Change: R152P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112805
Gene: ENSMUSG00000025409
AA Change: R152P

DomainStartEndE-ValueType
Blast:MBD 26 79 8e-10 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 269 295 N/A INTRINSIC
low complexity region 311 342 N/A INTRINSIC
low complexity region 347 378 N/A INTRINSIC
low complexity region 383 428 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 461 498 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 634 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
low complexity region 653 674 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 733 798 N/A INTRINSIC
low complexity region 813 847 N/A INTRINSIC
low complexity region 851 888 N/A INTRINSIC
low complexity region 947 956 N/A INTRINSIC
low complexity region 976 1000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126243
SMART Domains Protein: ENSMUSP00000115238
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
low complexity region 31 76 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 109 146 N/A INTRINSIC
low complexity region 148 165 N/A INTRINSIC
low complexity region 181 211 N/A INTRINSIC
low complexity region 214 282 N/A INTRINSIC
low complexity region 284 300 N/A INTRINSIC
low complexity region 301 322 N/A INTRINSIC
low complexity region 324 334 N/A INTRINSIC
low complexity region 381 446 N/A INTRINSIC
low complexity region 462 496 N/A INTRINSIC
low complexity region 500 537 N/A INTRINSIC
low complexity region 596 610 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134686
Predicted Effect probably benign
Transcript: ENSMUST00000136169
SMART Domains Protein: ENSMUSP00000122504
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 55 64 N/A INTRINSIC
low complexity region 84 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139091
SMART Domains Protein: ENSMUSP00000118339
Gene: ENSMUSG00000025408

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
BRLZ 94 160 1.23e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000154851
SMART Domains Protein: ENSMUSP00000133835
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 2 61 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
low complexity region 101 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156208
SMART Domains Protein: ENSMUSP00000114590
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
SCOP:d1qk9a_ 22 88 6e-5 SMART
Blast:MBD 26 79 6e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000172567
SMART Domains Protein: ENSMUSP00000134527
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 1 66 N/A INTRINSIC
low complexity region 81 115 N/A INTRINSIC
low complexity region 119 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218752
Predicted Effect probably benign
Transcript: ENSMUST00000230446
Meta Mutation Damage Score 0.0886 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Acaa1a A G 9: 119,349,490 probably null Het
Agbl5 T C 5: 30,904,723 S756P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Cdc16 C T 8: 13,769,489 Q362* probably null Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Cep170b C T 12: 112,738,468 Q887* probably null Het
Chd9 T C 8: 91,036,591 I2348T probably damaging Het
Clec9a A G 6: 129,421,038 probably benign Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
D130040H23Rik T C 8: 69,302,927 I328T probably benign Het
Dido1 G T 2: 180,660,935 D1725E possibly damaging Het
Dnajb14 A G 3: 137,892,870 D123G probably null Het
Dock2 A T 11: 34,689,760 M661K probably damaging Het
Esam C T 9: 37,537,130 probably null Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fat2 G T 11: 55,278,998 H2978Q probably benign Het
Fbn1 T C 2: 125,320,926 T2147A possibly damaging Het
Fdft1 T C 14: 63,156,621 T214A probably damaging Het
Fhl5 T C 4: 25,211,252 S147G probably benign Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gcat A T 15: 79,042,097 T56S possibly damaging Het
Gemin5 A T 11: 58,156,628 probably null Het
Gm4736 A T 6: 132,115,677 noncoding transcript Het
Grin2b T C 6: 135,843,110 N368S probably benign Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Htr1f G A 16: 64,925,897 P344L probably damaging Het
Ighv7-3 T A 12: 114,153,299 Y81F probably damaging Het
Jakmip3 C A 7: 139,017,745 probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Khdrbs3 T C 15: 69,049,375 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Myom2 T G 8: 15,085,294 I499S probably benign Het
Nos2 T A 11: 78,959,695 F1126L possibly damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pou6f1 C A 15: 100,580,924 V368L probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rbm45 A G 2: 76,379,018 E392G probably damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Rnf222 G T 11: 68,893,156 R183L probably damaging Het
Robo1 C T 16: 73,035,917 T1526I probably benign Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Slc13a2 A G 11: 78,400,840 F329S probably benign Het
Smc2 T C 4: 52,476,850 probably benign Het
Sycp2 A T 2: 178,401,653 probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tgfbr2 T C 9: 116,129,833 Y146C probably damaging Het
Tnfrsf11a A G 1: 105,809,405 D79G possibly damaging Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Ubn1 A G 16: 5,074,379 probably benign Het
Ubp1 T C 9: 113,951,686 probably null Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Other mutations in Mbd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Mbd6 APN 10 127284119 unclassified probably benign
IGL01685:Mbd6 APN 10 127284732 unclassified probably benign
IGL02741:Mbd6 APN 10 127287394 critical splice donor site probably null
IGL03090:Mbd6 APN 10 127287144 missense probably damaging 1.00
IGL03395:Mbd6 APN 10 127283417 missense probably damaging 1.00
R0041:Mbd6 UTSW 10 127286872 missense probably damaging 1.00
R0480:Mbd6 UTSW 10 127285873 unclassified probably benign
R0507:Mbd6 UTSW 10 127283520 unclassified probably benign
R1686:Mbd6 UTSW 10 127287417 missense probably damaging 0.99
R3419:Mbd6 UTSW 10 127286503 missense probably null 0.83
R3724:Mbd6 UTSW 10 127283891 unclassified probably benign
R3731:Mbd6 UTSW 10 127285768 unclassified probably benign
R3742:Mbd6 UTSW 10 127284943 unclassified probably benign
R3800:Mbd6 UTSW 10 127285167 unclassified probably benign
R5023:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5024:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5053:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5056:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5568:Mbd6 UTSW 10 127283428 missense possibly damaging 0.82
R5656:Mbd6 UTSW 10 127285286 unclassified probably benign
R7607:Mbd6 UTSW 10 127285230 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGCATCGCTACAGTGGAAG -3'
(R):5'- GAAAGGACATGGTTGTGACTTG -3'

Sequencing Primer
(F):5'- CACCAGGTTGGATCGGAG -3'
(R):5'- ACTTGTGGGCACTGGGAC -3'
Posted On2015-02-18