Incidental Mutation 'R3418:Olfr399'
ID266919
Institutional Source Beutler Lab
Gene Symbol Olfr399
Ensembl Gene ENSMUSG00000043692
Gene Nameolfactory receptor 399
SynonymsGA_x6K02T2P1NL-4211516-4210581, MOR255-1
MMRRC Submission 040636-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R3418 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74053127-74056615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74053988 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 257 (T257I)
Ref Sequence ENSEMBL: ENSMUSP00000149917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059440] [ENSMUST00000206280] [ENSMUST00000215915]
Predicted Effect probably damaging
Transcript: ENSMUST00000059440
AA Change: T257I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056508
Gene: ENSMUSG00000043692
AA Change: T257I

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 9.9e-55 PFAM
Pfam:7tm_1 44 293 1.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125093
Predicted Effect probably benign
Transcript: ENSMUST00000206280
Predicted Effect probably damaging
Transcript: ENSMUST00000215915
AA Change: T257I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Acaa1a A G 9: 119,349,490 probably null Het
Agbl5 T C 5: 30,904,723 S756P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Cdc16 C T 8: 13,769,489 Q362* probably null Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Cep170b C T 12: 112,738,468 Q887* probably null Het
Chd9 T C 8: 91,036,591 I2348T probably damaging Het
Clec9a A G 6: 129,421,038 probably benign Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
D130040H23Rik T C 8: 69,302,927 I328T probably benign Het
Dido1 G T 2: 180,660,935 D1725E possibly damaging Het
Dnajb14 A G 3: 137,892,870 D123G probably null Het
Dock2 A T 11: 34,689,760 M661K probably damaging Het
Esam C T 9: 37,537,130 probably null Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fat2 G T 11: 55,278,998 H2978Q probably benign Het
Fbn1 T C 2: 125,320,926 T2147A possibly damaging Het
Fdft1 T C 14: 63,156,621 T214A probably damaging Het
Fhl5 T C 4: 25,211,252 S147G probably benign Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gcat A T 15: 79,042,097 T56S possibly damaging Het
Gemin5 A T 11: 58,156,628 probably null Het
Gm4736 A T 6: 132,115,677 noncoding transcript Het
Grin2b T C 6: 135,843,110 N368S probably benign Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Htr1f G A 16: 64,925,897 P344L probably damaging Het
Ighv7-3 T A 12: 114,153,299 Y81F probably damaging Het
Jakmip3 C A 7: 139,017,745 probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Khdrbs3 T C 15: 69,049,375 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Myom2 T G 8: 15,085,294 I499S probably benign Het
Nos2 T A 11: 78,959,695 F1126L possibly damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pou6f1 C A 15: 100,580,924 V368L probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rbm45 A G 2: 76,379,018 E392G probably damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Rnf222 G T 11: 68,893,156 R183L probably damaging Het
Robo1 C T 16: 73,035,917 T1526I probably benign Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Slc13a2 A G 11: 78,400,840 F329S probably benign Het
Smc2 T C 4: 52,476,850 probably benign Het
Sycp2 A T 2: 178,401,653 probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tgfbr2 T C 9: 116,129,833 Y146C probably damaging Het
Tnfrsf11a A G 1: 105,809,405 D79G possibly damaging Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Ubn1 A G 16: 5,074,379 probably benign Het
Ubp1 T C 9: 113,951,686 probably null Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Other mutations in Olfr399
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Olfr399 APN 11 74054475 missense probably benign 0.41
R1344:Olfr399 UTSW 11 74054212 nonsense probably null
R1496:Olfr399 UTSW 11 74053824 makesense probably null
R1708:Olfr399 UTSW 11 74053988 missense probably damaging 0.99
R1911:Olfr399 UTSW 11 74054384 missense probably damaging 0.99
R2056:Olfr399 UTSW 11 74053993 nonsense probably null
R5444:Olfr399 UTSW 11 74053977 missense probably benign 0.19
R5470:Olfr399 UTSW 11 74053907 missense possibly damaging 0.90
R6150:Olfr399 UTSW 11 74054319 missense probably benign 0.03
R6442:Olfr399 UTSW 11 74054679 missense probably benign 0.00
R6687:Olfr399 UTSW 11 74054384 missense probably damaging 0.99
R7195:Olfr399 UTSW 11 74054397 missense probably damaging 1.00
R8052:Olfr399 UTSW 11 74054475 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AGCTCTGACATTGGTTAAGGCC -3'
(R):5'- TCCAACTCAATGAGCAGCTGC -3'

Sequencing Primer
(F):5'- AAAGAGTGTCATTAGTGGGCTACCTC -3'
(R):5'- GCTCTTTGTAGCAGCAGCC -3'
Posted On2015-02-18