Incidental Mutation 'R3418:Slc13a2'
ID266920
Institutional Source Beutler Lab
Gene Symbol Slc13a2
Ensembl Gene ENSMUSG00000001095
Gene Namesolute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2
Synonymssodium/dicarboxylate co-transporter, Nadc1, mNaDC-1
MMRRC Submission 040636-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3418 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78397087-78422217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78400840 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 329 (F329S)
Ref Sequence ENSEMBL: ENSMUSP00000001122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001122]
Predicted Effect probably benign
Transcript: ENSMUST00000001122
AA Change: F329S

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000001122
Gene: ENSMUSG00000001095
AA Change: F329S

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 6 560 7.1e-161 PFAM
Pfam:CitMHS 45 164 3e-15 PFAM
Pfam:CitMHS 203 499 1.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149865
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-coupled citrate transporter that is regulated by the chaperone activity of cyclophilin b. The encoded protein may play a role in the formation of kidney stones. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased Kreb cycle intermediates in the urine but otherwise have normal kidney function and response to ischemia-reperfusion injury and caloric restriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Acaa1a A G 9: 119,349,490 probably null Het
Agbl5 T C 5: 30,904,723 S756P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Cdc16 C T 8: 13,769,489 Q362* probably null Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Cep170b C T 12: 112,738,468 Q887* probably null Het
Chd9 T C 8: 91,036,591 I2348T probably damaging Het
Clec9a A G 6: 129,421,038 probably benign Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
D130040H23Rik T C 8: 69,302,927 I328T probably benign Het
Dido1 G T 2: 180,660,935 D1725E possibly damaging Het
Dnajb14 A G 3: 137,892,870 D123G probably null Het
Dock2 A T 11: 34,689,760 M661K probably damaging Het
Esam C T 9: 37,537,130 probably null Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fat2 G T 11: 55,278,998 H2978Q probably benign Het
Fbn1 T C 2: 125,320,926 T2147A possibly damaging Het
Fdft1 T C 14: 63,156,621 T214A probably damaging Het
Fhl5 T C 4: 25,211,252 S147G probably benign Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gcat A T 15: 79,042,097 T56S possibly damaging Het
Gemin5 A T 11: 58,156,628 probably null Het
Gm4736 A T 6: 132,115,677 noncoding transcript Het
Grin2b T C 6: 135,843,110 N368S probably benign Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Htr1f G A 16: 64,925,897 P344L probably damaging Het
Ighv7-3 T A 12: 114,153,299 Y81F probably damaging Het
Jakmip3 C A 7: 139,017,745 probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Khdrbs3 T C 15: 69,049,375 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Myom2 T G 8: 15,085,294 I499S probably benign Het
Nos2 T A 11: 78,959,695 F1126L possibly damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pou6f1 C A 15: 100,580,924 V368L probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rbm45 A G 2: 76,379,018 E392G probably damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Rnf222 G T 11: 68,893,156 R183L probably damaging Het
Robo1 C T 16: 73,035,917 T1526I probably benign Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Smc2 T C 4: 52,476,850 probably benign Het
Sycp2 A T 2: 178,401,653 probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tgfbr2 T C 9: 116,129,833 Y146C probably damaging Het
Tnfrsf11a A G 1: 105,809,405 D79G possibly damaging Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Ubn1 A G 16: 5,074,379 probably benign Het
Ubp1 T C 9: 113,951,686 probably null Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Other mutations in Slc13a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Slc13a2 APN 11 78400548 missense probably damaging 1.00
IGL01604:Slc13a2 APN 11 78403395 missense possibly damaging 0.82
IGL01679:Slc13a2 APN 11 78404711 missense probably damaging 1.00
IGL03100:Slc13a2 APN 11 78404473 missense probably damaging 1.00
IGL03380:Slc13a2 APN 11 78399082 missense probably benign 0.03
deliberate UTSW 11 78403480 critical splice acceptor site probably benign
intentional UTSW 11 78404708 missense probably damaging 1.00
R0085:Slc13a2 UTSW 11 78406868 missense probably damaging 0.96
R0324:Slc13a2 UTSW 11 78404524 missense probably damaging 1.00
R0368:Slc13a2 UTSW 11 78404800 nonsense probably null
R0440:Slc13a2 UTSW 11 78403175 missense probably benign 0.05
R0539:Slc13a2 UTSW 11 78399138 missense probably damaging 1.00
R1519:Slc13a2 UTSW 11 78397746 missense possibly damaging 0.59
R1550:Slc13a2 UTSW 11 78403164 missense probably damaging 1.00
R1909:Slc13a2 UTSW 11 78400142 missense possibly damaging 0.90
R2166:Slc13a2 UTSW 11 78403075 missense probably benign 0.16
R2994:Slc13a2 UTSW 11 78404737 missense probably damaging 1.00
R2998:Slc13a2 UTSW 11 78404785 missense probably damaging 0.99
R3932:Slc13a2 UTSW 11 78398400 missense probably damaging 1.00
R4233:Slc13a2 UTSW 11 78403535 intron probably benign
R4462:Slc13a2 UTSW 11 78404387 missense probably benign 0.44
R5014:Slc13a2 UTSW 11 78400161 missense possibly damaging 0.73
R5170:Slc13a2 UTSW 11 78400808 missense probably damaging 1.00
R5484:Slc13a2 UTSW 11 78404822 splice site probably benign
R5809:Slc13a2 UTSW 11 78397821 missense probably damaging 1.00
R5973:Slc13a2 UTSW 11 78400532 missense probably damaging 0.99
R6243:Slc13a2 UTSW 11 78404708 missense probably damaging 1.00
R6263:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6275:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6276:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6279:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6280:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6300:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6305:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6314:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6673:Slc13a2 UTSW 11 78397831 missense probably benign 0.12
R7138:Slc13a2 UTSW 11 78399124 missense possibly damaging 0.76
R7382:Slc13a2 UTSW 11 78404795 missense probably damaging 1.00
R7657:Slc13a2 UTSW 11 78398397 missense probably damaging 0.99
R7791:Slc13a2 UTSW 11 78422064 critical splice donor site probably null
R8027:Slc13a2 UTSW 11 78404756 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCATCTGATACCATGCTGTG -3'
(R):5'- GACATTAGGGCTTGCCCATG -3'

Sequencing Primer
(F):5'- ACAGAGAAGGGTCCCTCC -3'
(R):5'- GCCTGGTGCAGAGCCTTTATAC -3'
Posted On2015-02-18