Incidental Mutation 'R3418:Sel1l'
ID266923
Institutional Source Beutler Lab
Gene Symbol Sel1l
Ensembl Gene ENSMUSG00000020964
Gene Namesel-1 suppressor of lin-12-like (C. elegans)
SynonymsSel1h
MMRRC Submission 040636-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3418 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location91806043-91849157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91810002 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 689 (W689R)
Ref Sequence ENSEMBL: ENSMUSP00000136087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021347] [ENSMUST00000167466] [ENSMUST00000178462]
Predicted Effect probably damaging
Transcript: ENSMUST00000021347
AA Change: W739R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021347
Gene: ENSMUSG00000020964
AA Change: W739R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FN2 116 164 1.24e-24 SMART
SEL1 179 214 2.48e-1 SMART
SEL1 215 250 7.5e1 SMART
SEL1 251 286 1.86e-5 SMART
SEL1 287 322 1.16e-1 SMART
SEL1 369 405 7.93e-9 SMART
SEL1 406 442 8.05e-10 SMART
SEL1 443 478 2.48e-10 SMART
SEL1 479 514 1.91e-11 SMART
SEL1 515 550 9.04e-4 SMART
Pfam:Sel1 585 622 3.4e-1 PFAM
SEL1 623 658 4.42e-7 SMART
SEL1 660 695 2.28e-9 SMART
low complexity region 766 790 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166691
Predicted Effect probably damaging
Transcript: ENSMUST00000167466
AA Change: W689R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129384
Gene: ENSMUSG00000020964
AA Change: W689R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SEL1 129 164 2.48e-1 SMART
SEL1 165 200 7.5e1 SMART
SEL1 201 236 1.86e-5 SMART
SEL1 237 272 1.16e-1 SMART
SEL1 319 355 7.93e-9 SMART
SEL1 356 392 8.05e-10 SMART
SEL1 393 428 2.48e-10 SMART
SEL1 429 464 1.91e-11 SMART
SEL1 465 500 9.04e-4 SMART
Pfam:Sel1 534 572 1.5e-1 PFAM
SEL1 573 608 4.42e-7 SMART
SEL1 610 645 2.28e-9 SMART
low complexity region 716 740 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178462
AA Change: W689R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136087
Gene: ENSMUSG00000020964
AA Change: W689R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SEL1 129 164 2.48e-1 SMART
SEL1 165 200 7.5e1 SMART
SEL1 201 236 1.86e-5 SMART
SEL1 237 272 1.16e-1 SMART
SEL1 319 355 7.93e-9 SMART
SEL1 356 392 8.05e-10 SMART
SEL1 393 428 2.48e-10 SMART
SEL1 429 464 1.91e-11 SMART
SEL1 465 500 9.04e-4 SMART
Pfam:Sel1 535 572 3.2e-1 PFAM
SEL1 573 608 4.42e-7 SMART
SEL1 610 645 2.28e-9 SMART
low complexity region 716 740 N/A INTRINSIC
Meta Mutation Damage Score 0.8142 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protein complex required for the retrotranslocation or dislocation of misfolded proteins from the endoplasmic reticulum lumen to the cytosol, where they are degraded by the proteasome in a ubiquitin-dependent manner. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality with impaired exocrine and endocrine pancreatic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Acaa1a A G 9: 119,349,490 probably null Het
Agbl5 T C 5: 30,904,723 S756P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Cdc16 C T 8: 13,769,489 Q362* probably null Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Cep170b C T 12: 112,738,468 Q887* probably null Het
Chd9 T C 8: 91,036,591 I2348T probably damaging Het
Clec9a A G 6: 129,421,038 probably benign Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
D130040H23Rik T C 8: 69,302,927 I328T probably benign Het
Dido1 G T 2: 180,660,935 D1725E possibly damaging Het
Dnajb14 A G 3: 137,892,870 D123G probably null Het
Dock2 A T 11: 34,689,760 M661K probably damaging Het
Esam C T 9: 37,537,130 probably null Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fat2 G T 11: 55,278,998 H2978Q probably benign Het
Fbn1 T C 2: 125,320,926 T2147A possibly damaging Het
Fdft1 T C 14: 63,156,621 T214A probably damaging Het
Fhl5 T C 4: 25,211,252 S147G probably benign Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gcat A T 15: 79,042,097 T56S possibly damaging Het
Gemin5 A T 11: 58,156,628 probably null Het
Gm4736 A T 6: 132,115,677 noncoding transcript Het
Grin2b T C 6: 135,843,110 N368S probably benign Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Htr1f G A 16: 64,925,897 P344L probably damaging Het
Ighv7-3 T A 12: 114,153,299 Y81F probably damaging Het
Jakmip3 C A 7: 139,017,745 probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Khdrbs3 T C 15: 69,049,375 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Myom2 T G 8: 15,085,294 I499S probably benign Het
Nos2 T A 11: 78,959,695 F1126L possibly damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pou6f1 C A 15: 100,580,924 V368L probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rbm45 A G 2: 76,379,018 E392G probably damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Rnf222 G T 11: 68,893,156 R183L probably damaging Het
Robo1 C T 16: 73,035,917 T1526I probably benign Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Slc13a2 A G 11: 78,400,840 F329S probably benign Het
Smc2 T C 4: 52,476,850 probably benign Het
Sycp2 A T 2: 178,401,653 probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tgfbr2 T C 9: 116,129,833 Y146C probably damaging Het
Tnfrsf11a A G 1: 105,809,405 D79G possibly damaging Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Ubn1 A G 16: 5,074,379 probably benign Het
Ubp1 T C 9: 113,951,686 probably null Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Other mutations in Sel1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Sel1l APN 12 91814613 splice site probably benign
IGL01082:Sel1l APN 12 91811908 missense probably benign 0.41
IGL01402:Sel1l APN 12 91841833 missense possibly damaging 0.55
IGL01610:Sel1l APN 12 91817290 missense probably damaging 1.00
IGL01690:Sel1l APN 12 91843259 missense probably benign
IGL01803:Sel1l APN 12 91830730 missense probably benign 0.37
IGL01939:Sel1l APN 12 91816247 missense probably damaging 1.00
IGL02275:Sel1l APN 12 91815015 missense probably damaging 1.00
IGL02279:Sel1l APN 12 91814997 missense probably damaging 1.00
IGL02407:Sel1l APN 12 91843268 splice site probably benign
IGL02934:Sel1l APN 12 91809936 nonsense probably null
R0533:Sel1l UTSW 12 91820094 missense probably damaging 1.00
R0565:Sel1l UTSW 12 91811889 missense probably benign 0.16
R0565:Sel1l UTSW 12 91813945 missense possibly damaging 0.95
R0973:Sel1l UTSW 12 91824860 missense probably damaging 1.00
R1378:Sel1l UTSW 12 91833097 splice site probably null
R1505:Sel1l UTSW 12 91813962 missense probably damaging 1.00
R1530:Sel1l UTSW 12 91826684 missense probably damaging 0.96
R2001:Sel1l UTSW 12 91826550 nonsense probably null
R3419:Sel1l UTSW 12 91810002 missense probably damaging 1.00
R4601:Sel1l UTSW 12 91833053 critical splice donor site probably null
R4776:Sel1l UTSW 12 91813893 missense probably damaging 1.00
R4839:Sel1l UTSW 12 91833158 missense probably benign 0.00
R4860:Sel1l UTSW 12 91831602 missense probably damaging 1.00
R4860:Sel1l UTSW 12 91831602 missense probably damaging 1.00
R4869:Sel1l UTSW 12 91814054 intron probably benign
R5261:Sel1l UTSW 12 91824884 missense possibly damaging 0.92
R5692:Sel1l UTSW 12 91811878 missense probably benign 0.02
R5744:Sel1l UTSW 12 91809980 missense possibly damaging 0.95
R5830:Sel1l UTSW 12 91833171 missense probably damaging 1.00
R6799:Sel1l UTSW 12 91814968 splice site probably null
R7291:Sel1l UTSW 12 91848965 missense probably benign
R8493:Sel1l UTSW 12 91813961 nonsense probably null
Z1176:Sel1l UTSW 12 91825297 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAGCGTTCTCAGCAAG -3'
(R):5'- CCTCTGGGTGTCAGTAGAAGAAG -3'

Sequencing Primer
(F):5'- CCGACCAAGGTGAGTGTGTG -3'
(R):5'- GGGTTTAAAAATCATCACAGTGTCC -3'
Posted On2015-02-18