Incidental Mutation 'R3418:Ubn1'
ID266929
Institutional Source Beutler Lab
Gene Symbol Ubn1
Ensembl Gene ENSMUSG00000039473
Gene Nameubinuclein 1
Synonyms1110029L11Rik, 2610108L02Rik
MMRRC Submission 040636-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock #R3418 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location5050057-5086289 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 5074379 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052449] [ENSMUST00000229126] [ENSMUST00000229570] [ENSMUST00000230703]
Predicted Effect probably benign
Transcript: ENSMUST00000052449
SMART Domains Protein: ENSMUSP00000061843
Gene: ENSMUSG00000039473

DomainStartEndE-ValueType
Pfam:HUN 117 168 1.4e-22 PFAM
low complexity region 181 224 N/A INTRINSIC
low complexity region 232 238 N/A INTRINSIC
low complexity region 250 267 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
Pfam:UBN_AB 353 573 2.4e-80 PFAM
low complexity region 792 804 N/A INTRINSIC
low complexity region 856 882 N/A INTRINSIC
low complexity region 905 934 N/A INTRINSIC
low complexity region 970 984 N/A INTRINSIC
low complexity region 996 1006 N/A INTRINSIC
low complexity region 1016 1034 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229386
Predicted Effect probably benign
Transcript: ENSMUST00000229570
Predicted Effect probably benign
Transcript: ENSMUST00000230703
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cellular senescence is a hallmark of tumor suppression and tissue aging. Senescent cells contain domains of heterochromatin, called senescence-associated heterochromatin foci (SAHF), that repress proliferation-promoting genes. The protein encoded by this gene binds to proliferation-promoting genes and is required for SAHF formation, enhancing methylation of histone H3. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Acaa1a A G 9: 119,349,490 probably null Het
Agbl5 T C 5: 30,904,723 S756P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Cdc16 C T 8: 13,769,489 Q362* probably null Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Cep170b C T 12: 112,738,468 Q887* probably null Het
Chd9 T C 8: 91,036,591 I2348T probably damaging Het
Clec9a A G 6: 129,421,038 probably benign Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
D130040H23Rik T C 8: 69,302,927 I328T probably benign Het
Dido1 G T 2: 180,660,935 D1725E possibly damaging Het
Dnajb14 A G 3: 137,892,870 D123G probably null Het
Dock2 A T 11: 34,689,760 M661K probably damaging Het
Esam C T 9: 37,537,130 probably null Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fat2 G T 11: 55,278,998 H2978Q probably benign Het
Fbn1 T C 2: 125,320,926 T2147A possibly damaging Het
Fdft1 T C 14: 63,156,621 T214A probably damaging Het
Fhl5 T C 4: 25,211,252 S147G probably benign Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gcat A T 15: 79,042,097 T56S possibly damaging Het
Gemin5 A T 11: 58,156,628 probably null Het
Gm4736 A T 6: 132,115,677 noncoding transcript Het
Grin2b T C 6: 135,843,110 N368S probably benign Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Htr1f G A 16: 64,925,897 P344L probably damaging Het
Ighv7-3 T A 12: 114,153,299 Y81F probably damaging Het
Jakmip3 C A 7: 139,017,745 probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Khdrbs3 T C 15: 69,049,375 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Myom2 T G 8: 15,085,294 I499S probably benign Het
Nos2 T A 11: 78,959,695 F1126L possibly damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pou6f1 C A 15: 100,580,924 V368L probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rbm45 A G 2: 76,379,018 E392G probably damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Rnf222 G T 11: 68,893,156 R183L probably damaging Het
Robo1 C T 16: 73,035,917 T1526I probably benign Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Slc13a2 A G 11: 78,400,840 F329S probably benign Het
Smc2 T C 4: 52,476,850 probably benign Het
Sycp2 A T 2: 178,401,653 probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tgfbr2 T C 9: 116,129,833 Y146C probably damaging Het
Tnfrsf11a A G 1: 105,809,405 D79G possibly damaging Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Ubp1 T C 9: 113,951,686 probably null Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Other mutations in Ubn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ubn1 APN 16 5081914 missense probably benign 0.00
IGL01726:Ubn1 APN 16 5073470 critical splice donor site probably null
IGL01744:Ubn1 APN 16 5072059 missense probably damaging 1.00
IGL01777:Ubn1 APN 16 5072149 missense possibly damaging 0.46
IGL02110:Ubn1 APN 16 5081890 splice site probably benign
IGL02667:Ubn1 APN 16 5062599 missense probably damaging 1.00
IGL03345:Ubn1 APN 16 5081964 missense probably damaging 0.98
R0201:Ubn1 UTSW 16 5064614 missense probably damaging 1.00
R0437:Ubn1 UTSW 16 5072184 critical splice donor site probably benign
R0514:Ubn1 UTSW 16 5073071 missense probably damaging 1.00
R0550:Ubn1 UTSW 16 5062620 splice site probably null
R0919:Ubn1 UTSW 16 5064391 missense probably damaging 1.00
R1183:Ubn1 UTSW 16 5064542 missense probably damaging 1.00
R1339:Ubn1 UTSW 16 5055335 missense probably damaging 0.99
R1440:Ubn1 UTSW 16 5077294 missense probably damaging 1.00
R1836:Ubn1 UTSW 16 5077391 missense probably benign
R2024:Ubn1 UTSW 16 5064623 missense probably damaging 1.00
R2026:Ubn1 UTSW 16 5064650 missense probably damaging 1.00
R2105:Ubn1 UTSW 16 5077224 nonsense probably null
R2896:Ubn1 UTSW 16 5055219 missense possibly damaging 0.60
R3721:Ubn1 UTSW 16 5073378 missense possibly damaging 0.59
R4033:Ubn1 UTSW 16 5064611 missense probably damaging 1.00
R4398:Ubn1 UTSW 16 5064425 missense probably damaging 0.99
R4547:Ubn1 UTSW 16 5072092 missense probably damaging 1.00
R4646:Ubn1 UTSW 16 5077987 missense probably damaging 0.99
R4870:Ubn1 UTSW 16 5077313 missense probably damaging 1.00
R5018:Ubn1 UTSW 16 5063725 missense probably damaging 1.00
R5220:Ubn1 UTSW 16 5077954 missense probably benign 0.02
R5394:Ubn1 UTSW 16 5074369 missense possibly damaging 0.51
R6217:Ubn1 UTSW 16 5077232 missense probably damaging 1.00
R6372:Ubn1 UTSW 16 5081638 missense possibly damaging 0.84
R6418:Ubn1 UTSW 16 5081927 missense probably benign
R6823:Ubn1 UTSW 16 5064547 missense probably damaging 1.00
R7028:Ubn1 UTSW 16 5055324 missense probably damaging 1.00
R7203:Ubn1 UTSW 16 5077216 missense possibly damaging 0.57
R7498:Ubn1 UTSW 16 5077105 missense probably damaging 0.99
R7596:Ubn1 UTSW 16 5081558 missense probably benign 0.25
R8383:Ubn1 UTSW 16 5077358 missense possibly damaging 0.95
R8514:Ubn1 UTSW 16 5073399 missense probably damaging 1.00
R8559:Ubn1 UTSW 16 5064770 missense possibly damaging 0.64
R8699:Ubn1 UTSW 16 5063703 missense possibly damaging 0.79
RF018:Ubn1 UTSW 16 5064392 missense probably damaging 1.00
X0067:Ubn1 UTSW 16 5055338 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCAACAAAGCCATTGACTTTC -3'
(R):5'- CTTCAGGACAGTTGGCACATG -3'

Sequencing Primer
(F):5'- CAAAGCCATTGACTTTCTTGATGGC -3'
(R):5'- GCACATGGCCCAAACAGG -3'
Posted On2015-02-18