Incidental Mutation 'R3418:Rnf168'
ID266930
Institutional Source Beutler Lab
Gene Symbol Rnf168
Ensembl Gene ENSMUSG00000014074
Gene Namering finger protein 168
Synonyms3110001H15Rik
MMRRC Submission 040636-MU
Accession Numbers

Ncbi RefSeq: NM_027355.2; MGI:1917488

Is this an essential gene? Probably essential (E-score: 0.811) question?
Stock #R3418 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location32277459-32301434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32299192 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 524 (N524D)
Ref Sequence ENSEMBL: ENSMUSP00000126484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014218] [ENSMUST00000171474]
Predicted Effect probably benign
Transcript: ENSMUST00000014218
AA Change: N522D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000014218
Gene: ENSMUSG00000014074
AA Change: N522D

DomainStartEndE-ValueType
RING 16 54 8.23e-6 SMART
coiled coil region 114 184 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171474
AA Change: N524D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126484
Gene: ENSMUSG00000014074
AA Change: N524D

DomainStartEndE-ValueType
RING 18 56 8.23e-6 SMART
coiled coil region 116 186 N/A INTRINSIC
low complexity region 210 223 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase protein that contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The protein is involved in DNA double-strand break (DSB) repair. Mutations in this gene result in Riddle syndrome. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit immunodeficient, increased radiosensitivity and age-dependent reduction in male infertility. [provided by MGI curators]
Allele List at MGI

All alleles(56) : Gene trapped(56)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Acaa1a A G 9: 119,349,490 probably null Het
Agbl5 T C 5: 30,904,723 S756P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Cdc16 C T 8: 13,769,489 Q362* probably null Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Cep170b C T 12: 112,738,468 Q887* probably null Het
Chd9 T C 8: 91,036,591 I2348T probably damaging Het
Clec9a A G 6: 129,421,038 probably benign Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
D130040H23Rik T C 8: 69,302,927 I328T probably benign Het
Dido1 G T 2: 180,660,935 D1725E possibly damaging Het
Dnajb14 A G 3: 137,892,870 D123G probably null Het
Dock2 A T 11: 34,689,760 M661K probably damaging Het
Esam C T 9: 37,537,130 probably null Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fat2 G T 11: 55,278,998 H2978Q probably benign Het
Fbn1 T C 2: 125,320,926 T2147A possibly damaging Het
Fdft1 T C 14: 63,156,621 T214A probably damaging Het
Fhl5 T C 4: 25,211,252 S147G probably benign Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gcat A T 15: 79,042,097 T56S possibly damaging Het
Gemin5 A T 11: 58,156,628 probably null Het
Gm4736 A T 6: 132,115,677 noncoding transcript Het
Grin2b T C 6: 135,843,110 N368S probably benign Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Htr1f G A 16: 64,925,897 P344L probably damaging Het
Ighv7-3 T A 12: 114,153,299 Y81F probably damaging Het
Jakmip3 C A 7: 139,017,745 probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Khdrbs3 T C 15: 69,049,375 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Myom2 T G 8: 15,085,294 I499S probably benign Het
Nos2 T A 11: 78,959,695 F1126L possibly damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pou6f1 C A 15: 100,580,924 V368L probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rbm45 A G 2: 76,379,018 E392G probably damaging Het
Rnf222 G T 11: 68,893,156 R183L probably damaging Het
Robo1 C T 16: 73,035,917 T1526I probably benign Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Slc13a2 A G 11: 78,400,840 F329S probably benign Het
Smc2 T C 4: 52,476,850 probably benign Het
Sycp2 A T 2: 178,401,653 probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tgfbr2 T C 9: 116,129,833 Y146C probably damaging Het
Tnfrsf11a A G 1: 105,809,405 D79G possibly damaging Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Ubn1 A G 16: 5,074,379 probably benign Het
Ubp1 T C 9: 113,951,686 probably null Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Other mutations in Rnf168
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02997:Rnf168 APN 16 32285421 missense probably damaging 1.00
IGL03108:Rnf168 APN 16 32278281 missense possibly damaging 0.79
P0021:Rnf168 UTSW 16 32298887 missense probably damaging 0.96
R0038:Rnf168 UTSW 16 32298995 missense probably benign 0.05
R0038:Rnf168 UTSW 16 32298995 missense probably benign 0.05
R0040:Rnf168 UTSW 16 32278173 unclassified probably null
R0049:Rnf168 UTSW 16 32298469 missense possibly damaging 0.56
R0049:Rnf168 UTSW 16 32298469 missense possibly damaging 0.56
R0760:Rnf168 UTSW 16 32298386 critical splice acceptor site probably null
R1188:Rnf168 UTSW 16 32298659 missense probably benign 0.00
R1386:Rnf168 UTSW 16 32298963 missense probably damaging 1.00
R1754:Rnf168 UTSW 16 32299124 missense probably benign
R2118:Rnf168 UTSW 16 32278218 missense probably damaging 1.00
R2122:Rnf168 UTSW 16 32278218 missense probably damaging 1.00
R2124:Rnf168 UTSW 16 32278218 missense probably damaging 1.00
R2520:Rnf168 UTSW 16 32278403 missense probably benign 0.17
R2852:Rnf168 UTSW 16 32282374 missense probably damaging 0.99
R3419:Rnf168 UTSW 16 32299192 missense probably benign 0.00
R4886:Rnf168 UTSW 16 32299196 missense probably benign 0.00
R5335:Rnf168 UTSW 16 32298584 missense possibly damaging 0.78
R5738:Rnf168 UTSW 16 32282374 missense probably damaging 0.99
R6570:Rnf168 UTSW 16 32289210 missense probably benign 0.00
R7165:Rnf168 UTSW 16 32282361 missense probably benign 0.38
R7529:Rnf168 UTSW 16 32298914 missense probably damaging 0.98
R7556:Rnf168 UTSW 16 32299045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTACAACTTCAGAAAGAGGTAG -3'
(R):5'- GGACAGAAGAGCTAGCTTTGC -3'

Sequencing Primer
(F):5'- ACTTCAGAAAGAGGTAGATAAAGAGC -3'
(R):5'- CAGAAGAGCTAGCTTTGCAATAC -3'
Posted On2015-02-18