Mutagenetix > Incidental Mutations

Incidental Mutation 'R3418:Myof'

266933

Institutional Source

Beutler Lab

Gene Symbol

Myof

Ensembl Gene

ENSMUSG00000048612

Gene Name

myoferlin

Synonyms

Fer1l3, E030042N20Rik, 2310051D19Rik

MMRRC Submission

040636-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3418 (G1)

Quality Score

188

Status

Validated

Chromosome

Chromosomal Location

37899036-38043577 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 37922978 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1502 (S1502P)

Ref Sequence

ENSEMBL: ENSMUSP00000129792 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000225159] [ENSMUST00000226068]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041475
AA Change: S1502P

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612
AA Change: S1502P

Domain	Start	End	E-Value	Type
C2	1	100	7.56e-16	SMART
low complexity region	142	159	N/A	INTRINSIC
C2	200	299	4.03e-11	SMART
FerI	282	353	2.76e-37	SMART
C2	359	473	2.93e-13	SMART
low complexity region	532	543	N/A	INTRINSIC
FerA	663	728	5.07e-27	SMART
FerB	755	829	2.39e-46	SMART
DysFN	843	901	6.42e-21	SMART
DysFN	914	970	1.16e-18	SMART
DysFC	979	1017	1.04e-11	SMART
DysFC	1037	1070	1.62e-8	SMART
C2	1127	1234	5.03e-12	SMART
C2	1289	1396	1.15e1	SMART
low complexity region	1425	1436	N/A	INTRINSIC
low complexity region	1515	1526	N/A	INTRINSIC
C2	1541	1640	2.66e-11	SMART
C2	1776	1905	2.81e-1	SMART
Pfam:Ferlin_C	1939	2043	2.4e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172095
AA Change: S1502P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612
AA Change: S1502P

Domain	Start	End	E-Value	Type
C2	1	100	7.56e-16	SMART
low complexity region	142	159	N/A	INTRINSIC
C2	200	299	4.03e-11	SMART
FerI	282	353	2.76e-37	SMART
C2	359	473	2.93e-13	SMART
low complexity region	532	543	N/A	INTRINSIC
FerA	663	728	5.07e-27	SMART
FerB	755	829	2.39e-46	SMART
DysFN	843	901	6.42e-21	SMART
DysFN	914	970	1.16e-18	SMART
DysFC	979	1017	1.04e-11	SMART
DysFC	1037	1070	1.62e-8	SMART
C2	1127	1234	5.03e-12	SMART
C2	1289	1396	1.15e1	SMART
low complexity region	1515	1526	N/A	INTRINSIC
C2	1541	1640	2.66e-11	SMART
C2	1776	1905	2.81e-1	SMART
transmembrane domain	2013	2035	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224518

Predicted Effect

probably benign
Transcript: ENSMUST00000225159

Predicted Effect

probably benign
Transcript: ENSMUST00000226068
AA Change: S1515P

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)

Meta Mutation Damage Score

0.1365

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.6%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5530400C23Rik	A	G	6: 133,294,119	Q42R	probably benign	Het
Acaa1a	A	G	9: 119,349,490		probably null	Het
Agbl5	T	C	5: 30,904,723	S756P	probably damaging	Het
Armc9	T	C	1: 86,194,338	L395P	probably damaging	Het
Cdc16	C	T	8: 13,769,489	Q362*	probably null	Het
Cdh5	C	T	8: 104,129,370	R312C	probably damaging	Het
Cep170b	C	T	12: 112,738,468	Q887*	probably null	Het
Chd9	T	C	8: 91,036,591	I2348T	probably damaging	Het
Clec9a	A	G	6: 129,421,038		probably benign	Het
Col6a3	T	C	1: 90,804,091	D873G	probably benign	Het
D130040H23Rik	T	C	8: 69,302,927	I328T	probably benign	Het
Dido1	G	T	2: 180,660,935	D1725E	possibly damaging	Het
Dnajb14	A	G	3: 137,892,870	D123G	probably null	Het
Dock2	A	T	11: 34,689,760	M661K	probably damaging	Het
Esam	C	T	9: 37,537,130		probably null	Het
Fam20c	A	T	5: 138,757,868	N220Y	probably damaging	Het
Fat2	G	T	11: 55,278,998	H2978Q	probably benign	Het
Fbn1	T	C	2: 125,320,926	T2147A	possibly damaging	Het
Fdft1	T	C	14: 63,156,621	T214A	probably damaging	Het
Fhl5	T	C	4: 25,211,252	S147G	probably benign	Het
Flrt2	A	G	12: 95,780,604	Y572C	probably damaging	Het
Gcat	A	T	15: 79,042,097	T56S	possibly damaging	Het
Gemin5	A	T	11: 58,156,628		probably null	Het
Gm4736	A	T	6: 132,115,677		noncoding transcript	Het
Grin2b	T	C	6: 135,843,110	N368S	probably benign	Het
Gsto1	T	C	19: 47,857,905	F64L	probably benign	Het
Gucy1a1	A	G	3: 82,106,133	S401P	probably damaging	Het
Htr1f	G	A	16: 64,925,897	P344L	probably damaging	Het
Ighv7-3	T	A	12: 114,153,299	Y81F	probably damaging	Het
Jakmip3	C	A	7: 139,017,745		probably benign	Het
Kcnj13	T	C	1: 87,386,919	T194A	probably benign	Het
Khdrbs3	T	C	15: 69,049,375		probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lyn	A	T	4: 3,746,833	I204F	probably damaging	Het
Mbd6	C	G	10: 127,286,503	R152P	probably null	Het
Myom2	T	G	8: 15,085,294	I499S	probably benign	Het
Nos2	T	A	11: 78,959,695	F1126L	possibly damaging	Het
Olfr399	G	A	11: 74,053,988	T257I	probably damaging	Het
P2ry1	T	C	3: 61,003,712	F91L	probably damaging	Het
Pcdh15	C	A	10: 74,584,222	D1166E	probably benign	Het
Pou6f1	C	A	15: 100,580,924	V368L	probably benign	Het
Ptcd3	A	T	6: 71,883,486	I579K	possibly damaging	Het
Rbm45	A	G	2: 76,379,018	E392G	probably damaging	Het
Rnf168	A	G	16: 32,299,192	N524D	probably benign	Het
Rnf222	G	T	11: 68,893,156	R183L	probably damaging	Het
Robo1	C	T	16: 73,035,917	T1526I	probably benign	Het
Sel1l	A	G	12: 91,810,002	W689R	probably damaging	Het
Serpinb13	T	C	1: 106,998,927	S218P	probably damaging	Het
Serpini1	A	G	3: 75,640,282	Y367C	probably damaging	Het
Slc13a2	A	G	11: 78,400,840	F329S	probably benign	Het
Smc2	T	C	4: 52,476,850		probably benign	Het
Sycp2	A	T	2: 178,401,653		probably benign	Het
Tab2	G	A	10: 7,907,481	P679L	probably damaging	Het
Tdrd1	T	A	19: 56,831,231	N54K	possibly damaging	Het
Tgfbr2	T	C	9: 116,129,833	Y146C	probably damaging	Het
Tnfrsf11a	A	G	1: 105,809,405	D79G	possibly damaging	Het
Trpa1	T	C	1: 14,874,381	I1046M	probably benign	Het
Ubn1	A	G	16: 5,074,379		probably benign	Het
Ubp1	T	C	9: 113,951,686		probably null	Het
Vmn2r2	A	T	3: 64,116,899	F754I	probably benign	Het

Other mutations in Myof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Myof	APN	19	37960934	missense	probably benign	0.16
IGL00764:Myof	APN	19	37974923	missense	probably benign	0.04
IGL00801:Myof	APN	19	37986073	missense	probably damaging	0.99
IGL01084:Myof	APN	19	37936436	missense	probably damaging	1.00
IGL01368:Myof	APN	19	37936457	missense	probably damaging	0.97
IGL01472:Myof	APN	19	37923076	missense	probably benign
IGL01785:Myof	APN	19	37980423	nonsense	probably null
IGL02205:Myof	APN	19	37924635	missense	probably damaging	1.00
IGL02268:Myof	APN	19	37954429	missense	possibly damaging	0.50
IGL02268:Myof	APN	19	37974863	missense	possibly damaging	0.90
IGL02339:Myof	APN	19	37972213	missense	possibly damaging	0.46
IGL02433:Myof	APN	19	37972193	missense	probably benign	0.05
IGL02481:Myof	APN	19	37937913	nonsense	probably null
IGL02536:Myof	APN	19	37949655	missense	probably damaging	0.97
IGL02682:Myof	APN	19	37921481	missense	probably benign	0.09
IGL02732:Myof	APN	19	37977716	missense	possibly damaging	0.50
IGL02887:Myof	APN	19	37920779	critical splice acceptor site	probably null
IGL03114:Myof	APN	19	37903861	missense	probably damaging	1.00
IGL03137:Myof	APN	19	37974889	missense	probably damaging	1.00
IGL03340:Myof	APN	19	37911159	missense	probably damaging	1.00
PIT4791001:Myof	UTSW	19	37982958	critical splice donor site	probably null
R0024:Myof	UTSW	19	37915740	missense	probably damaging	0.98
R0140:Myof	UTSW	19	37951556	nonsense	probably null
R0309:Myof	UTSW	19	37981266	missense	probably benign	0.12
R0330:Myof	UTSW	19	37935878	missense	probably damaging	1.00
R0345:Myof	UTSW	19	38024345	missense	probably damaging	1.00
R0349:Myof	UTSW	19	37910969	missense	probably damaging	0.99
R0463:Myof	UTSW	19	37916504	missense	probably damaging	1.00
R0507:Myof	UTSW	19	37901277	missense	possibly damaging	0.94
R0512:Myof	UTSW	19	37954524	missense	possibly damaging	0.54
R0608:Myof	UTSW	19	37916504	missense	probably damaging	1.00
R0723:Myof	UTSW	19	37981260	missense	probably damaging	1.00
R1081:Myof	UTSW	19	37986088	missense	probably damaging	0.99
R1196:Myof	UTSW	19	37910960	missense	probably damaging	1.00
R1243:Myof	UTSW	19	37936092	missense	probably damaging	1.00
R1371:Myof	UTSW	19	37903668	splice site	probably benign
R1381:Myof	UTSW	19	37995485	missense	probably damaging	1.00
R1419:Myof	UTSW	19	37901911	missense	probably damaging	1.00
R1527:Myof	UTSW	19	37924619	missense	probably damaging	1.00
R1672:Myof	UTSW	19	37943479	missense	probably damaging	1.00
R1864:Myof	UTSW	19	37986705	missense	probably benign
R1914:Myof	UTSW	19	37977693	missense	probably damaging	1.00
R1915:Myof	UTSW	19	37977693	missense	probably damaging	1.00
R1970:Myof	UTSW	19	37945634	missense	probably damaging	0.99
R2062:Myof	UTSW	19	37915746	missense	possibly damaging	0.94
R2144:Myof	UTSW	19	37981221	critical splice donor site	probably null
R2243:Myof	UTSW	19	37901319	missense	probably damaging	1.00
R2339:Myof	UTSW	19	37937927	missense	probably damaging	1.00
R2484:Myof	UTSW	19	37903843	missense	probably benign	0.13
R2880:Myof	UTSW	19	37923025	missense	probably benign	0.04
R3967:Myof	UTSW	19	37901263	missense	probably damaging	1.00
R3967:Myof	UTSW	19	38022610	missense	possibly damaging	0.59
R3970:Myof	UTSW	19	37901263	missense	probably damaging	1.00
R3970:Myof	UTSW	19	38022610	missense	possibly damaging	0.59
R4238:Myof	UTSW	19	37923008	nonsense	probably null
R4405:Myof	UTSW	19	37922978	missense	probably damaging	0.97
R4406:Myof	UTSW	19	37922978	missense	probably damaging	0.97
R4407:Myof	UTSW	19	37922978	missense	probably damaging	0.97
R4408:Myof	UTSW	19	37922978	missense	probably damaging	0.97
R4561:Myof	UTSW	19	37922990	missense	probably benign
R4606:Myof	UTSW	19	37967099	missense	probably damaging	1.00
R4778:Myof	UTSW	19	37949563	missense	probably damaging	1.00
R4801:Myof	UTSW	19	37945738	missense	probably benign	0.24
R4802:Myof	UTSW	19	37945738	missense	probably benign	0.24
R4812:Myof	UTSW	19	37916559	missense	probably damaging	1.00
R4884:Myof	UTSW	19	37942357	missense	probably damaging	1.00
R4964:Myof	UTSW	19	37935852	missense	probably damaging	0.97
R4966:Myof	UTSW	19	37935852	missense	probably damaging	0.97
R5069:Myof	UTSW	19	37905325	missense	possibly damaging	0.65
R5181:Myof	UTSW	19	37932623	missense	possibly damaging	0.95
R5376:Myof	UTSW	19	37916400	missense	probably damaging	1.00
R5384:Myof	UTSW	19	37952987	missense	probably damaging	0.98
R5543:Myof	UTSW	19	37981330	missense	probably benign	0.00
R5626:Myof	UTSW	19	37922990	missense	probably benign
R5865:Myof	UTSW	19	37910934	missense	probably damaging	1.00
R5919:Myof	UTSW	19	38024370	missense	possibly damaging	0.95
R5924:Myof	UTSW	19	37982973	missense	probably damaging	0.97
R5997:Myof	UTSW	19	37905299	missense	possibly damaging	0.90
R5999:Myof	UTSW	19	37939856	nonsense	probably null
R6039:Myof	UTSW	19	37977684	missense	probably damaging	1.00
R6039:Myof	UTSW	19	37977684	missense	probably damaging	1.00
R6041:Myof	UTSW	19	37924620	missense	probably damaging	1.00
R6051:Myof	UTSW	19	38024361	missense	probably damaging	1.00
R6057:Myof	UTSW	19	37926981	critical splice donor site	probably null
R6089:Myof	UTSW	19	37967060	missense	probably benign	0.37
R6195:Myof	UTSW	19	37913357	missense	possibly damaging	0.89
R6478:Myof	UTSW	19	37903831	missense	probably damaging	1.00
R6545:Myof	UTSW	19	37942297	missense	possibly damaging	0.67
R6655:Myof	UTSW	19	37934791	missense	probably damaging	1.00
R6715:Myof	UTSW	19	37968346	missense	probably benign	0.04
R6737:Myof	UTSW	19	37943514	missense	probably benign	0.01
R6837:Myof	UTSW	19	37922956	critical splice donor site	probably null
R7096:Myof	UTSW	19	37936200	missense	probably damaging	1.00
R7308:Myof	UTSW	19	37910911	missense	probably damaging	0.98
R7328:Myof	UTSW	19	37916399	missense	probably damaging	1.00
R7485:Myof	UTSW	19	37951491	nonsense	probably null
R7554:Myof	UTSW	19	37954510	missense	probably benign	0.09
R7759:Myof	UTSW	19	37939898	missense	probably benign	0.00
R7779:Myof	UTSW	19	37939390	missense	probably damaging	1.00
X0024:Myof	UTSW	19	37974597	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- GCAATATCCTGACTCCCCTG -3'
(R):5'- AGTTCTATGCTGCACCCGTG -3'

Sequencing Primer
(F):5'- CCCTGGGGGCATTTTCC -3'
(R):5'- GCCCCAGGAGTTCTGTCCAATC -3'

Posted On

2015-02-18