Mutagenetix > Incidental Mutations

Incidental Mutation 'R3419:Serpinb13'

266942

Institutional Source

Beutler Lab

Gene Symbol

Serpinb13

Ensembl Gene

ENSMUSG00000048775

Gene Name

serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13

Synonyms

HURPIN, headpin, HUR7, PI13

MMRRC Submission

040637-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

R3419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106980984-107001195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106998927 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 218 (S218P)

Ref Sequence

ENSEMBL: ENSMUSP00000027564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027564
AA Change: S218P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: S218P

Domain	Start	End	E-Value	Type
SERPIN	13	389	1.55e-144	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000136766

SMART Domains

Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775

Domain	Start	End	E-Value	Type
Pfam:Serpin	6	94	1.1e-16	PFAM

Meta Mutation Damage Score

0.2210

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5530400C23Rik	A	G	6: 133,294,119	Q42R	probably benign	Het
Ankrd26	A	G	6: 118,535,107	L518P	probably damaging	Het
Armc9	T	C	1: 86,194,338	L395P	probably damaging	Het
Baz1a	T	C	12: 54,946,899	K181E	probably benign	Het
Bend3	T	C	10: 43,509,982	S124P	probably damaging	Het
Cdh5	C	T	8: 104,129,370	R312C	probably damaging	Het
Col6a3	T	C	1: 90,804,091	D873G	probably benign	Het
Dmbx1	G	C	4: 115,920,676	R64G	probably benign	Het
Dpy19l2	T	C	9: 24,581,205	E699G	probably damaging	Het
Eef2k	T	A	7: 120,885,870	M320K	probably damaging	Het
Exoc5	A	T	14: 49,023,278	N377K	probably damaging	Het
Fam20c	A	T	5: 138,757,868	N220Y	probably damaging	Het
Fchsd2	T	A	7: 101,278,660		probably null	Het
Flrt2	A	G	12: 95,780,604	Y572C	probably damaging	Het
Gm17093	A	G	14: 44,521,590	I190V	unknown	Het
Gsto1	T	C	19: 47,857,905	F64L	probably benign	Het
Gucy1a1	A	G	3: 82,106,133	S401P	probably damaging	Het
Hoxd10	A	G	2: 74,692,577	K200E	probably benign	Het
Kcnj13	T	C	1: 87,386,919	T194A	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lacc1	T	G	14: 77,034,881	E158D	probably benign	Het
Lyn	A	T	4: 3,746,833	I204F	probably damaging	Het
Mapk6	T	C	9: 75,397,757	E126G	probably damaging	Het
Mbd6	C	G	10: 127,286,503	R152P	probably null	Het
Olfr146	C	T	9: 39,019,076	C155Y	probably benign	Het
Olfr672	A	G	7: 104,996,520	I128T	probably damaging	Het
Olfr93	A	T	17: 37,151,351	V53E	probably damaging	Het
P2ry1	T	C	3: 61,003,712	F91L	probably damaging	Het
Paqr3	A	G	5: 97,099,700	L183P	probably damaging	Het
Pcdh15	C	A	10: 74,584,222	D1166E	probably benign	Het
Pik3r1	T	C	13: 101,692,215	D25G	probably benign	Het
Poc5	A	T	13: 96,404,417	T365S	possibly damaging	Het
Polr3a	A	G	14: 24,467,035	L716P	probably damaging	Het
Ppp1r3a	A	T	6: 14,719,414	D500E	probably benign	Het
Ptcd3	A	T	6: 71,883,486	I579K	possibly damaging	Het
Rnf168	A	G	16: 32,299,192	N524D	probably benign	Het
Scn7a	AT	ATT	2: 66,700,895		probably null	Het
Sel1l	A	G	12: 91,810,002	W689R	probably damaging	Het
Serpini1	A	G	3: 75,640,282	Y367C	probably damaging	Het
Snrnp48	G	A	13: 38,221,359	D248N	possibly damaging	Het
St6galnac4	A	G	2: 32,595,731	T217A	probably damaging	Het
Tdrd1	T	A	19: 56,831,231	N54K	possibly damaging	Het
Tmem30c	A	G	16: 57,277,668	V130A	probably benign	Het
Trpa1	T	C	1: 14,874,381	I1046M	probably benign	Het
Tulp2	T	A	7: 45,518,752	M196K	possibly damaging	Het
Unc5b	G	A	10: 60,778,814	R235W	probably damaging	Het
Vmn1r175	A	T	7: 23,808,650	M184K	probably damaging	Het
Vmn2r2	A	T	3: 64,116,899	F754I	probably benign	Het
Vmn2r9	A	C	5: 108,846,433	M450R	probably damaging	Het
Wdr60	C	T	12: 116,224,977	V666I	probably benign	Het

Other mutations in Serpinb13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Serpinb13	APN	1	106996380	missense	probably damaging	1.00
IGL01758:Serpinb13	APN	1	107000754	missense	probably damaging	1.00
IGL02078:Serpinb13	APN	1	106998958	missense	probably damaging	0.99
IGL02183:Serpinb13	APN	1	106998910	missense	probably damaging	1.00
PIT4651001:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R0683:Serpinb13	UTSW	1	106999021	missense	probably damaging	1.00
R1263:Serpinb13	UTSW	1	107000736	missense	probably damaging	0.97
R1535:Serpinb13	UTSW	1	106982156	start codon destroyed	probably null	1.00
R1929:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2271:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2655:Serpinb13	UTSW	1	107000427	missense	probably damaging	0.99
R3115:Serpinb13	UTSW	1	106982838	missense	probably null	0.15
R3418:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3883:Serpinb13	UTSW	1	106998572	missense	probably benign	0.37
R4664:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4666:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4689:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4690:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4725:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4728:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4847:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R5249:Serpinb13	UTSW	1	106998697	missense	probably damaging	1.00
R5501:Serpinb13	UTSW	1	106982185	missense	possibly damaging	0.81
R5507:Serpinb13	UTSW	1	106998602	missense	probably benign	0.00
R6015:Serpinb13	UTSW	1	107000607	missense	probably benign	0.00
R6363:Serpinb13	UTSW	1	107000774	nonsense	probably null
R6720:Serpinb13	UTSW	1	106994062	missense	probably benign	0.12
R6847:Serpinb13	UTSW	1	106998933	missense	probably benign	0.24
R7237:Serpinb13	UTSW	1	106998949	missense	probably damaging	1.00
Z1177:Serpinb13	UTSW	1	106982303	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CAGTCTAATGTCATTTGGCCAAG -3'
(R):5'- ACAGCGAGGCATCAAATGTTC -3'

Sequencing Primer
(F):5'- GGCCAAGTGATTATTCAGTTACTCAG -3'
(R):5'- CAAATGTTCAGAAGCCTTGTTCCCAG -3'

Posted On

2015-02-18