Incidental Mutation 'R3419:Dmbx1'
ID266951
Institutional Source Beutler Lab
Gene Symbol Dmbx1
Ensembl Gene ENSMUSG00000028707
Gene Namediencephalon/mesencephalon homeobox 1
SynonymsAtx, Cdmx, Dmbx1, Mbx, Otx3
MMRRC Submission 040637-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R3419 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location115915119-115939926 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 115920676 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 64 (R64G)
Ref Sequence ENSEMBL: ENSMUSP00000120320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064806] [ENSMUST00000084338] [ENSMUST00000124071]
Predicted Effect probably benign
Transcript: ENSMUST00000064806
AA Change: R64G

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134457
Gene: ENSMUSG00000028707
AA Change: R64G

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HOX 66 128 6.07e-26 SMART
low complexity region 172 187 N/A INTRINSIC
low complexity region 235 256 N/A INTRINSIC
low complexity region 284 295 N/A INTRINSIC
low complexity region 330 348 N/A INTRINSIC
Pfam:OAR 349 368 9.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084338
AA Change: R69G

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000081366
Gene: ENSMUSG00000028707
AA Change: R69G

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HOX 71 133 6.07e-26 SMART
low complexity region 177 192 N/A INTRINSIC
low complexity region 240 261 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 335 353 N/A INTRINSIC
Pfam:OAR 355 372 3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124071
AA Change: R64G

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120320
Gene: ENSMUSG00000028707
AA Change: R64G

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HOX 66 128 6.07e-26 SMART
low complexity region 172 187 N/A INTRINSIC
low complexity region 235 256 N/A INTRINSIC
low complexity region 284 295 N/A INTRINSIC
low complexity region 330 348 N/A INTRINSIC
Pfam:OAR 349 368 9.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bicoid sub-family of homeodomain-containing transcription factors. The encoded protein acts as a transcription factor and may play a role in brain and sensory organ development. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one null allele display partial postnatal lethality, impaired suckling and postnatal growth, and reduced female fertility. When raised in isolation, mice homozygous for another null allele exhibit decreased body weight, decreased food consumption, and small adipocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Ankrd26 A G 6: 118,535,107 L518P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Baz1a T C 12: 54,946,899 K181E probably benign Het
Bend3 T C 10: 43,509,982 S124P probably damaging Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
Dpy19l2 T C 9: 24,581,205 E699G probably damaging Het
Eef2k T A 7: 120,885,870 M320K probably damaging Het
Exoc5 A T 14: 49,023,278 N377K probably damaging Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fchsd2 T A 7: 101,278,660 probably null Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gm17093 A G 14: 44,521,590 I190V unknown Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Hoxd10 A G 2: 74,692,577 K200E probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lacc1 T G 14: 77,034,881 E158D probably benign Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mapk6 T C 9: 75,397,757 E126G probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Olfr146 C T 9: 39,019,076 C155Y probably benign Het
Olfr672 A G 7: 104,996,520 I128T probably damaging Het
Olfr93 A T 17: 37,151,351 V53E probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Paqr3 A G 5: 97,099,700 L183P probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pik3r1 T C 13: 101,692,215 D25G probably benign Het
Poc5 A T 13: 96,404,417 T365S possibly damaging Het
Polr3a A G 14: 24,467,035 L716P probably damaging Het
Ppp1r3a A T 6: 14,719,414 D500E probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Snrnp48 G A 13: 38,221,359 D248N possibly damaging Het
St6galnac4 A G 2: 32,595,731 T217A probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tmem30c A G 16: 57,277,668 V130A probably benign Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Tulp2 T A 7: 45,518,752 M196K possibly damaging Het
Unc5b G A 10: 60,778,814 R235W probably damaging Het
Vmn1r175 A T 7: 23,808,650 M184K probably damaging Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Vmn2r9 A C 5: 108,846,433 M450R probably damaging Het
Wdr60 C T 12: 116,224,977 V666I probably benign Het
Other mutations in Dmbx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Dmbx1 APN 4 115920006 missense probably benign 0.00
IGL02850:Dmbx1 APN 4 115918007 missense probably damaging 1.00
R0014:Dmbx1 UTSW 4 115918024 missense probably damaging 0.99
R0014:Dmbx1 UTSW 4 115918024 missense probably damaging 0.99
R0267:Dmbx1 UTSW 4 115918112 missense probably benign 0.41
R1164:Dmbx1 UTSW 4 115918258 missense probably damaging 1.00
R2567:Dmbx1 UTSW 4 115920292 missense probably damaging 1.00
R5383:Dmbx1 UTSW 4 115918145 missense probably damaging 1.00
R5882:Dmbx1 UTSW 4 115920301 missense probably damaging 1.00
R5999:Dmbx1 UTSW 4 115918176 missense probably damaging 0.98
R7064:Dmbx1 UTSW 4 115918268 missense probably damaging 1.00
R7483:Dmbx1 UTSW 4 115923711 missense probably damaging 1.00
R7829:Dmbx1 UTSW 4 115923907 intron probably benign
Predicted Primers PCR Primer
(F):5'- GATGGCTAGCACCTATCTGCAAG -3'
(R):5'- AATTTCCGATCCCAGCCAGTG -3'

Sequencing Primer
(F):5'- CACCTATCTGCAAGATACAGTTGGG -3'
(R):5'- GGATGGGTAATTTCCAAGGACC -3'
Posted On2015-02-18