Incidental Mutation 'R3419:Paqr3'
ID 266952
Institutional Source Beutler Lab
Gene Symbol Paqr3
Ensembl Gene ENSMUSG00000055725
Gene Name progestin and adipoQ receptor family member III
Synonyms 6330415A20Rik, RKTG
MMRRC Submission 040637-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock # R3419 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 97082329-97111596 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 97099700 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 183 (L183P)
Ref Sequence ENSEMBL: ENSMUSP00000108593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069453] [ENSMUST00000112968] [ENSMUST00000112969] [ENSMUST00000196078]
AlphaFold Q6TCG8
Predicted Effect probably damaging
Transcript: ENSMUST00000069453
AA Change: L183P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069324
Gene: ENSMUSG00000055725
AA Change: L183P

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 3.4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112968
SMART Domains Protein: ENSMUSP00000108592
Gene: ENSMUSG00000055725

DomainStartEndE-ValueType
Pfam:HlyIII 64 171 1.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112969
AA Change: L183P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108593
Gene: ENSMUSG00000055725
AA Change: L183P

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 1.4e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132127
Predicted Effect probably benign
Transcript: ENSMUST00000196078
SMART Domains Protein: ENSMUSP00000142871
Gene: ENSMUSG00000055725

DomainStartEndE-ValueType
Pfam:HlyIII 64 179 7e-24 PFAM
transmembrane domain 181 203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Targeted deletion of this gene causes faster chemical carcinogen-induced skin cell proliferation, higher epidermal thickness, increased number and size of skin papillomas, shorter tumor latency and delayed tumor regression. Heterozygotes develop tumors earlier and more frequently than control mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Ankrd26 A G 6: 118,535,107 L518P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Baz1a T C 12: 54,946,899 K181E probably benign Het
Bend3 T C 10: 43,509,982 S124P probably damaging Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
Dmbx1 G C 4: 115,920,676 R64G probably benign Het
Dpy19l2 T C 9: 24,581,205 E699G probably damaging Het
Eef2k T A 7: 120,885,870 M320K probably damaging Het
Exoc5 A T 14: 49,023,278 N377K probably damaging Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fchsd2 T A 7: 101,278,660 probably null Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gm17093 A G 14: 44,521,590 I190V unknown Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Hoxd10 A G 2: 74,692,577 K200E probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lacc1 T G 14: 77,034,881 E158D probably benign Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mapk6 T C 9: 75,397,757 E126G probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Olfr146 C T 9: 39,019,076 C155Y probably benign Het
Olfr672 A G 7: 104,996,520 I128T probably damaging Het
Olfr93 A T 17: 37,151,351 V53E probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pik3r1 T C 13: 101,692,215 D25G probably benign Het
Poc5 A T 13: 96,404,417 T365S possibly damaging Het
Polr3a A G 14: 24,467,035 L716P probably damaging Het
Ppp1r3a A T 6: 14,719,414 D500E probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Snrnp48 G A 13: 38,221,359 D248N possibly damaging Het
St6galnac4 A G 2: 32,595,731 T217A probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tmem30c A G 16: 57,277,668 V130A probably benign Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Tulp2 T A 7: 45,518,752 M196K possibly damaging Het
Unc5b G A 10: 60,778,814 R235W probably damaging Het
Vmn1r175 A T 7: 23,808,650 M184K probably damaging Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Vmn2r9 A C 5: 108,846,433 M450R probably damaging Het
Wdr60 C T 12: 116,224,977 V666I probably benign Het
Other mutations in Paqr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Paqr3 APN 5 97095937 missense probably benign
IGL01966:Paqr3 APN 5 97099643 missense probably benign 0.21
IGL02133:Paqr3 APN 5 97095931 missense probably benign
PIT4618001:Paqr3 UTSW 5 97103471 missense possibly damaging 0.82
R1601:Paqr3 UTSW 5 97111389 missense probably benign 0.01
R2864:Paqr3 UTSW 5 97099736 missense possibly damaging 0.65
R3799:Paqr3 UTSW 5 97111316 missense probably damaging 1.00
R4352:Paqr3 UTSW 5 97099596 missense probably benign 0.05
R4368:Paqr3 UTSW 5 97108291 missense probably damaging 1.00
R4515:Paqr3 UTSW 5 97103361 missense possibly damaging 0.72
R4583:Paqr3 UTSW 5 97108210 nonsense probably null
R4647:Paqr3 UTSW 5 97108210 nonsense probably null
R4648:Paqr3 UTSW 5 97108210 nonsense probably null
R4811:Paqr3 UTSW 5 97095983 missense probably benign 0.00
R4855:Paqr3 UTSW 5 97108194 missense possibly damaging 0.83
R5910:Paqr3 UTSW 5 97096028 splice site probably null
R6053:Paqr3 UTSW 5 97111278 missense probably benign 0.12
R6156:Paqr3 UTSW 5 97108269 missense probably damaging 1.00
R6957:Paqr3 UTSW 5 97108251 missense possibly damaging 0.48
R6974:Paqr3 UTSW 5 97108287 missense probably damaging 1.00
R9201:Paqr3 UTSW 5 97097506 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCGATTACAGCGCTTTAACCAAG -3'
(R):5'- AGTTAACATTTGTGTGCGACG -3'

Sequencing Primer
(F):5'- TACAGCGCTTTAACCAAGGAATG -3'
(R):5'- TGCGACGCTCTTTAAAAGGG -3'
Posted On 2015-02-18