Incidental Mutation 'R3419:Ppp1r3a'
ID 266955
Institutional Source Beutler Lab
Gene Symbol Ppp1r3a
Ensembl Gene ENSMUSG00000042717
Gene Name protein phosphatase 1, regulatory subunit 3A
Synonyms RGL, GM
MMRRC Submission 040637-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3419 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 14713976-14755273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 14719413 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 500 (D500E)
Ref Sequence ENSEMBL: ENSMUSP00000049054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045096]
AlphaFold Q99MR9
Predicted Effect probably benign
Transcript: ENSMUST00000045096
AA Change: D500E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: D500E

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
Pfam:CBM_21 124 231 2.3e-32 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 636 646 N/A INTRINSIC
low complexity region 952 961 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,271,082 (GRCm39) Q42R probably benign Het
Ankrd26 A G 6: 118,512,068 (GRCm39) L518P probably damaging Het
Armc9 T C 1: 86,122,060 (GRCm39) L395P probably damaging Het
Baz1a T C 12: 54,993,684 (GRCm39) K181E probably benign Het
Bend3 T C 10: 43,385,978 (GRCm39) S124P probably damaging Het
Cdh5 C T 8: 104,856,002 (GRCm39) R312C probably damaging Het
Col6a3 T C 1: 90,731,813 (GRCm39) D873G probably benign Het
Dmbx1 G C 4: 115,777,873 (GRCm39) R64G probably benign Het
Dpy19l2 T C 9: 24,492,501 (GRCm39) E699G probably damaging Het
Dync2i1 C T 12: 116,188,597 (GRCm39) V666I probably benign Het
Eef2k T A 7: 120,485,093 (GRCm39) M320K probably damaging Het
Exoc5 A T 14: 49,260,735 (GRCm39) N377K probably damaging Het
Fam20c A T 5: 138,743,623 (GRCm39) N220Y probably damaging Het
Fchsd2 T A 7: 100,927,867 (GRCm39) probably null Het
Flrt2 A G 12: 95,747,378 (GRCm39) Y572C probably damaging Het
Gm17093 A G 14: 44,759,047 (GRCm39) I190V unknown Het
Gsto1 T C 19: 47,846,344 (GRCm39) F64L probably benign Het
Gucy1a1 A G 3: 82,013,440 (GRCm39) S401P probably damaging Het
Hoxd10 A G 2: 74,522,921 (GRCm39) K200E probably benign Het
Kcnj13 T C 1: 87,314,641 (GRCm39) T194A probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lacc1 T G 14: 77,272,321 (GRCm39) E158D probably benign Het
Lyn A T 4: 3,746,833 (GRCm39) I204F probably damaging Het
Mapk6 T C 9: 75,305,039 (GRCm39) E126G probably damaging Het
Mbd6 C G 10: 127,122,372 (GRCm39) R152P probably null Het
Or2h1b A T 17: 37,462,242 (GRCm39) V53E probably damaging Het
Or52e15 A G 7: 104,645,727 (GRCm39) I128T probably damaging Het
Or8g17 C T 9: 38,930,372 (GRCm39) C155Y probably benign Het
P2ry1 T C 3: 60,911,133 (GRCm39) F91L probably damaging Het
Paqr3 A G 5: 97,247,559 (GRCm39) L183P probably damaging Het
Pcdh15 C A 10: 74,420,054 (GRCm39) D1166E probably benign Het
Pik3r1 T C 13: 101,828,723 (GRCm39) D25G probably benign Het
Poc5 A T 13: 96,540,925 (GRCm39) T365S possibly damaging Het
Polr3a A G 14: 24,517,103 (GRCm39) L716P probably damaging Het
Ptcd3 A T 6: 71,860,470 (GRCm39) I579K possibly damaging Het
Rnf168 A G 16: 32,118,010 (GRCm39) N524D probably benign Het
Scn7a AT ATT 2: 66,531,239 (GRCm39) probably null Het
Sel1l A G 12: 91,776,776 (GRCm39) W689R probably damaging Het
Serpinb13 T C 1: 106,926,657 (GRCm39) S218P probably damaging Het
Serpini1 A G 3: 75,547,589 (GRCm39) Y367C probably damaging Het
Snrnp48 G A 13: 38,405,335 (GRCm39) D248N possibly damaging Het
St6galnac4 A G 2: 32,485,743 (GRCm39) T217A probably damaging Het
Tdrd1 T A 19: 56,819,663 (GRCm39) N54K possibly damaging Het
Tmem30c A G 16: 57,098,031 (GRCm39) V130A probably benign Het
Trpa1 T C 1: 14,944,605 (GRCm39) I1046M probably benign Het
Tulp2 T A 7: 45,168,176 (GRCm39) M196K possibly damaging Het
Unc5b G A 10: 60,614,593 (GRCm39) R235W probably damaging Het
Vmn1r175 A T 7: 23,508,075 (GRCm39) M184K probably damaging Het
Vmn2r2 A T 3: 64,024,320 (GRCm39) F754I probably benign Het
Vmn2r9 A C 5: 108,994,299 (GRCm39) M450R probably damaging Het
Other mutations in Ppp1r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ppp1r3a APN 6 14,755,083 (GRCm39) missense probably damaging 1.00
IGL00670:Ppp1r3a APN 6 14,719,059 (GRCm39) missense probably benign 0.22
IGL00703:Ppp1r3a APN 6 14,718,407 (GRCm39) missense probably benign 0.02
IGL00726:Ppp1r3a APN 6 14,717,851 (GRCm39) missense probably benign 0.42
IGL00742:Ppp1r3a APN 6 14,718,608 (GRCm39) missense probably benign 0.36
IGL01477:Ppp1r3a APN 6 14,718,345 (GRCm39) missense probably damaging 0.99
IGL01632:Ppp1r3a APN 6 14,754,810 (GRCm39) missense probably damaging 1.00
IGL02162:Ppp1r3a APN 6 14,717,714 (GRCm39) missense probably damaging 1.00
IGL02374:Ppp1r3a APN 6 14,718,599 (GRCm39) missense probably damaging 1.00
IGL02539:Ppp1r3a APN 6 14,718,458 (GRCm39) missense probably benign 0.01
IGL02563:Ppp1r3a APN 6 14,719,761 (GRCm39) missense probably benign 0.20
IGL02929:Ppp1r3a APN 6 14,719,810 (GRCm39) missense probably benign 0.00
IGL03110:Ppp1r3a APN 6 14,722,064 (GRCm39) splice site probably benign
IGL03290:Ppp1r3a APN 6 14,754,771 (GRCm39) missense probably damaging 1.00
IGL03326:Ppp1r3a APN 6 14,719,765 (GRCm39) missense probably damaging 0.96
P0041:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.00
PIT4445001:Ppp1r3a UTSW 6 14,717,776 (GRCm39) missense probably damaging 1.00
R0015:Ppp1r3a UTSW 6 14,717,660 (GRCm39) missense possibly damaging 0.58
R0077:Ppp1r3a UTSW 6 14,754,516 (GRCm39) missense possibly damaging 0.64
R0368:Ppp1r3a UTSW 6 14,718,959 (GRCm39) missense probably benign 0.26
R0391:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.43
R1793:Ppp1r3a UTSW 6 14,754,717 (GRCm39) missense probably damaging 1.00
R1797:Ppp1r3a UTSW 6 14,717,981 (GRCm39) missense probably benign 0.02
R1855:Ppp1r3a UTSW 6 14,754,993 (GRCm39) missense probably damaging 1.00
R1864:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R1865:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R2046:Ppp1r3a UTSW 6 14,722,103 (GRCm39) missense probably benign 0.12
R2122:Ppp1r3a UTSW 6 14,721,874 (GRCm39) missense possibly damaging 0.95
R2437:Ppp1r3a UTSW 6 14,718,322 (GRCm39) missense probably benign 0.03
R2518:Ppp1r3a UTSW 6 14,719,377 (GRCm39) missense possibly damaging 0.95
R2887:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2888:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2889:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R3886:Ppp1r3a UTSW 6 14,719,911 (GRCm39) missense possibly damaging 0.87
R3937:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R3938:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R4246:Ppp1r3a UTSW 6 14,719,780 (GRCm39) missense probably damaging 1.00
R4561:Ppp1r3a UTSW 6 14,754,681 (GRCm39) missense probably damaging 1.00
R4701:Ppp1r3a UTSW 6 14,718,992 (GRCm39) missense probably benign 0.00
R4853:Ppp1r3a UTSW 6 14,719,046 (GRCm39) missense probably benign 0.03
R5076:Ppp1r3a UTSW 6 14,754,680 (GRCm39) missense probably damaging 1.00
R5085:Ppp1r3a UTSW 6 14,719,603 (GRCm39) missense probably damaging 1.00
R5501:Ppp1r3a UTSW 6 14,719,417 (GRCm39) missense probably benign 0.02
R5725:Ppp1r3a UTSW 6 14,719,348 (GRCm39) missense probably benign 0.04
R5729:Ppp1r3a UTSW 6 14,719,762 (GRCm39) missense probably benign 0.06
R5741:Ppp1r3a UTSW 6 14,719,882 (GRCm39) missense probably damaging 0.97
R5841:Ppp1r3a UTSW 6 14,718,983 (GRCm39) missense probably benign 0.26
R5914:Ppp1r3a UTSW 6 14,718,988 (GRCm39) missense probably benign 0.09
R6091:Ppp1r3a UTSW 6 14,719,339 (GRCm39) missense probably benign 0.02
R6154:Ppp1r3a UTSW 6 14,754,603 (GRCm39) missense possibly damaging 0.88
R6218:Ppp1r3a UTSW 6 14,718,430 (GRCm39) missense probably damaging 0.99
R6813:Ppp1r3a UTSW 6 14,719,570 (GRCm39) missense probably benign 0.13
R6826:Ppp1r3a UTSW 6 14,718,980 (GRCm39) nonsense probably null
R6869:Ppp1r3a UTSW 6 14,754,825 (GRCm39) missense probably benign 0.39
R7109:Ppp1r3a UTSW 6 14,719,235 (GRCm39) missense probably benign 0.00
R7188:Ppp1r3a UTSW 6 14,719,190 (GRCm39) missense probably benign 0.00
R7262:Ppp1r3a UTSW 6 14,719,069 (GRCm39) missense probably benign 0.04
R7341:Ppp1r3a UTSW 6 14,718,749 (GRCm39) missense probably damaging 0.97
R7770:Ppp1r3a UTSW 6 14,754,977 (GRCm39) missense probably benign 0.06
R7856:Ppp1r3a UTSW 6 14,718,025 (GRCm39) missense probably benign 0.01
R8309:Ppp1r3a UTSW 6 14,719,700 (GRCm39) missense probably benign 0.02
R8422:Ppp1r3a UTSW 6 14,718,434 (GRCm39) nonsense probably null
R8868:Ppp1r3a UTSW 6 14,755,014 (GRCm39) missense probably damaging 1.00
R9039:Ppp1r3a UTSW 6 14,754,525 (GRCm39) missense probably damaging 1.00
R9149:Ppp1r3a UTSW 6 14,722,098 (GRCm39) missense probably benign 0.32
R9302:Ppp1r3a UTSW 6 14,721,891 (GRCm39) missense probably benign 0.00
R9399:Ppp1r3a UTSW 6 14,755,010 (GRCm39) missense probably damaging 0.99
R9565:Ppp1r3a UTSW 6 14,719,466 (GRCm39) missense probably benign 0.02
R9730:Ppp1r3a UTSW 6 14,721,923 (GRCm39) missense probably benign 0.25
R9767:Ppp1r3a UTSW 6 14,718,101 (GRCm39) missense probably benign 0.03
R9782:Ppp1r3a UTSW 6 14,718,766 (GRCm39) missense probably damaging 1.00
Z1177:Ppp1r3a UTSW 6 14,755,150 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AAGGACAGGGATCCACTGTC -3'
(R):5'- GGATGATAATGCCAACCCAGCC -3'

Sequencing Primer
(F):5'- CGCCCAGGTGTTAGCTGTAATATC -3'
(R):5'- CCAGCCAATGGGAGTGG -3'
Posted On 2015-02-18