Incidental Mutation 'R3419:Vmn1r175'
ID266961
Institutional Source Beutler Lab
Gene Symbol Vmn1r175
Ensembl Gene ENSMUSG00000095632
Gene Namevomeronasal 1 receptor 175
SynonymsGm6299
MMRRC Submission 040637-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3419 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location23807182-23810643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23808650 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 184 (M184K)
Ref Sequence ENSEMBL: ENSMUSP00000154170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166141] [ENSMUST00000228383]
Predicted Effect probably damaging
Transcript: ENSMUST00000166141
AA Change: M184K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126357
Gene: ENSMUSG00000095632
AA Change: M184K

DomainStartEndE-ValueType
Pfam:TAS2R 8 296 8.8e-15 PFAM
Pfam:7tm_1 13 285 2.5e-6 PFAM
Pfam:V1R 41 295 4.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228383
AA Change: M184K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Ankrd26 A G 6: 118,535,107 L518P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Baz1a T C 12: 54,946,899 K181E probably benign Het
Bend3 T C 10: 43,509,982 S124P probably damaging Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
Dmbx1 G C 4: 115,920,676 R64G probably benign Het
Dpy19l2 T C 9: 24,581,205 E699G probably damaging Het
Eef2k T A 7: 120,885,870 M320K probably damaging Het
Exoc5 A T 14: 49,023,278 N377K probably damaging Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fchsd2 T A 7: 101,278,660 probably null Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gm17093 A G 14: 44,521,590 I190V unknown Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Hoxd10 A G 2: 74,692,577 K200E probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lacc1 T G 14: 77,034,881 E158D probably benign Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mapk6 T C 9: 75,397,757 E126G probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Olfr146 C T 9: 39,019,076 C155Y probably benign Het
Olfr672 A G 7: 104,996,520 I128T probably damaging Het
Olfr93 A T 17: 37,151,351 V53E probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Paqr3 A G 5: 97,099,700 L183P probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pik3r1 T C 13: 101,692,215 D25G probably benign Het
Poc5 A T 13: 96,404,417 T365S possibly damaging Het
Polr3a A G 14: 24,467,035 L716P probably damaging Het
Ppp1r3a A T 6: 14,719,414 D500E probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Snrnp48 G A 13: 38,221,359 D248N possibly damaging Het
St6galnac4 A G 2: 32,595,731 T217A probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tmem30c A G 16: 57,277,668 V130A probably benign Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Tulp2 T A 7: 45,518,752 M196K possibly damaging Het
Unc5b G A 10: 60,778,814 R235W probably damaging Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Vmn2r9 A C 5: 108,846,433 M450R probably damaging Het
Wdr60 C T 12: 116,224,977 V666I probably benign Het
Other mutations in Vmn1r175
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02944:Vmn1r175 APN 7 23809166 missense probably damaging 0.97
PIT4531001:Vmn1r175 UTSW 7 23809178 missense possibly damaging 0.62
R1163:Vmn1r175 UTSW 7 23808512 missense probably benign 0.30
R1901:Vmn1r175 UTSW 7 23808793 missense probably benign 0.00
R1926:Vmn1r175 UTSW 7 23809041 missense possibly damaging 0.81
R1957:Vmn1r175 UTSW 7 23808383 missense probably benign 0.21
R2163:Vmn1r175 UTSW 7 23808927 missense probably benign 0.29
R2381:Vmn1r175 UTSW 7 23808668 missense probably benign 0.31
R3109:Vmn1r175 UTSW 7 23808968 missense probably benign 0.00
R3941:Vmn1r175 UTSW 7 23808968 missense probably benign 0.00
R4982:Vmn1r175 UTSW 7 23809069 missense possibly damaging 0.61
R5191:Vmn1r175 UTSW 7 23809022 missense possibly damaging 0.91
R5326:Vmn1r175 UTSW 7 23809106 missense possibly damaging 0.88
R5333:Vmn1r175 UTSW 7 23808579 missense possibly damaging 0.69
R5476:Vmn1r175 UTSW 7 23809131 missense possibly damaging 0.82
R5542:Vmn1r175 UTSW 7 23809106 missense possibly damaging 0.88
R5761:Vmn1r175 UTSW 7 23808480 missense probably benign 0.01
R5918:Vmn1r175 UTSW 7 23808947 missense probably damaging 1.00
R6163:Vmn1r175 UTSW 7 23809166 missense possibly damaging 0.71
R6563:Vmn1r175 UTSW 7 23808605 missense possibly damaging 0.61
R7476:Vmn1r175 UTSW 7 23808422 missense probably benign 0.01
R7616:Vmn1r175 UTSW 7 23808606 missense possibly damaging 0.79
R8100:Vmn1r175 UTSW 7 23808587 missense probably damaging 1.00
R8157:Vmn1r175 UTSW 7 23809098 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACCACCAGCAACAGGATG -3'
(R):5'- TGAGCACTTATCAGCTTGTCAC -3'

Sequencing Primer
(F):5'- AACAGGATGGTGTGGGATGCTC -3'
(R):5'- GAGCACTTATCAGCTTGTCACTCTTG -3'
Posted On2015-02-18