Incidental Mutation 'R3419:Fchsd2'
ID266965
Institutional Source Beutler Lab
Gene Symbol Fchsd2
Ensembl Gene ENSMUSG00000030691
Gene NameFCH and double SH3 domains 2
SynonymsSh3md3
MMRRC Submission 040637-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R3419 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location101092863-101284405 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 101278660 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032931] [ENSMUST00000098250] [ENSMUST00000207740]
Predicted Effect probably null
Transcript: ENSMUST00000032931
SMART Domains Protein: ENSMUSP00000032931
Gene: ENSMUSG00000030691

DomainStartEndE-ValueType
Pfam:FCH 21 103 1.3e-22 PFAM
coiled coil region 379 421 N/A INTRINSIC
low complexity region 466 474 N/A INTRINSIC
SH3 496 553 2.39e-14 SMART
low complexity region 554 569 N/A INTRINSIC
SH3 594 652 1.22e-20 SMART
low complexity region 676 695 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098250
SMART Domains Protein: ENSMUSP00000095850
Gene: ENSMUSG00000030691

DomainStartEndE-ValueType
Pfam:FCH 12 108 3.6e-23 PFAM
coiled coil region 355 397 N/A INTRINSIC
low complexity region 442 450 N/A INTRINSIC
SH3 472 529 2.39e-14 SMART
low complexity region 530 545 N/A INTRINSIC
SH3 570 628 1.22e-20 SMART
low complexity region 652 671 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207740
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Ankrd26 A G 6: 118,535,107 L518P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Baz1a T C 12: 54,946,899 K181E probably benign Het
Bend3 T C 10: 43,509,982 S124P probably damaging Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
Dmbx1 G C 4: 115,920,676 R64G probably benign Het
Dpy19l2 T C 9: 24,581,205 E699G probably damaging Het
Eef2k T A 7: 120,885,870 M320K probably damaging Het
Exoc5 A T 14: 49,023,278 N377K probably damaging Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gm17093 A G 14: 44,521,590 I190V unknown Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Hoxd10 A G 2: 74,692,577 K200E probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lacc1 T G 14: 77,034,881 E158D probably benign Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mapk6 T C 9: 75,397,757 E126G probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Olfr146 C T 9: 39,019,076 C155Y probably benign Het
Olfr672 A G 7: 104,996,520 I128T probably damaging Het
Olfr93 A T 17: 37,151,351 V53E probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Paqr3 A G 5: 97,099,700 L183P probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pik3r1 T C 13: 101,692,215 D25G probably benign Het
Poc5 A T 13: 96,404,417 T365S possibly damaging Het
Polr3a A G 14: 24,467,035 L716P probably damaging Het
Ppp1r3a A T 6: 14,719,414 D500E probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Snrnp48 G A 13: 38,221,359 D248N possibly damaging Het
St6galnac4 A G 2: 32,595,731 T217A probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tmem30c A G 16: 57,277,668 V130A probably benign Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Tulp2 T A 7: 45,518,752 M196K possibly damaging Het
Unc5b G A 10: 60,778,814 R235W probably damaging Het
Vmn1r175 A T 7: 23,808,650 M184K probably damaging Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Vmn2r9 A C 5: 108,846,433 M450R probably damaging Het
Wdr60 C T 12: 116,224,977 V666I probably benign Het
Other mutations in Fchsd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Fchsd2 APN 7 101271622 missense probably benign 0.26
IGL00910:Fchsd2 APN 7 101277626 missense probably benign 0.00
IGL02065:Fchsd2 APN 7 101177222 critical splice donor site probably null
IGL02545:Fchsd2 APN 7 101198508 missense probably benign
IGL02651:Fchsd2 APN 7 101277600 missense possibly damaging 0.60
IGL03286:Fchsd2 APN 7 101259775 critical splice donor site probably null
IGL03333:Fchsd2 APN 7 101198496 missense probably damaging 0.97
R0066:Fchsd2 UTSW 7 101278424 missense possibly damaging 0.60
R0066:Fchsd2 UTSW 7 101278424 missense possibly damaging 0.60
R0668:Fchsd2 UTSW 7 101196920 missense possibly damaging 0.63
R1281:Fchsd2 UTSW 7 101253552 missense possibly damaging 0.92
R1868:Fchsd2 UTSW 7 101250438 splice site probably benign
R1996:Fchsd2 UTSW 7 101278453 missense probably benign 0.00
R2024:Fchsd2 UTSW 7 101198533 missense possibly damaging 0.81
R2060:Fchsd2 UTSW 7 101277417 missense probably benign
R2243:Fchsd2 UTSW 7 101233885 missense probably benign 0.30
R3898:Fchsd2 UTSW 7 101191799 missense possibly damaging 0.90
R3899:Fchsd2 UTSW 7 101191799 missense possibly damaging 0.90
R3900:Fchsd2 UTSW 7 101191799 missense possibly damaging 0.90
R4496:Fchsd2 UTSW 7 101282495 missense probably benign 0.09
R4569:Fchsd2 UTSW 7 101277602 missense possibly damaging 0.60
R4667:Fchsd2 UTSW 7 101250449 missense probably damaging 1.00
R5408:Fchsd2 UTSW 7 101271574 missense possibly damaging 0.82
R5449:Fchsd2 UTSW 7 101277524 missense probably damaging 1.00
R5543:Fchsd2 UTSW 7 101271699 missense probably damaging 1.00
R5665:Fchsd2 UTSW 7 101110784 missense possibly damaging 0.50
R5894:Fchsd2 UTSW 7 101191752 missense probably benign 0.08
R5936:Fchsd2 UTSW 7 101191701 missense probably damaging 1.00
R6243:Fchsd2 UTSW 7 101271809 critical splice acceptor site probably benign
R6244:Fchsd2 UTSW 7 101259776 splice site probably null
R6247:Fchsd2 UTSW 7 101253540 missense probably benign
R6932:Fchsd2 UTSW 7 101277414 nonsense probably null
R7250:Fchsd2 UTSW 7 101259685 missense possibly damaging 0.61
R7418:Fchsd2 UTSW 7 101271624 missense possibly damaging 0.56
R7469:Fchsd2 UTSW 7 101278656 critical splice donor site probably null
R7522:Fchsd2 UTSW 7 101259622 nonsense probably null
R7921:Fchsd2 UTSW 7 101250542 missense probably benign 0.00
R8209:Fchsd2 UTSW 7 101282472 missense probably damaging 1.00
R8226:Fchsd2 UTSW 7 101282472 missense probably damaging 1.00
R8285:Fchsd2 UTSW 7 101233921 missense possibly damaging 0.56
R8400:Fchsd2 UTSW 7 101253573 missense possibly damaging 0.78
X0028:Fchsd2 UTSW 7 101110804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGATAAGAGGAGCTCCCAG -3'
(R):5'- CCGGTAAAGGCTGGGAGTAC -3'

Sequencing Primer
(F):5'- GATAAGAGGAGCTCCCAGTTCTTC -3'
(R):5'- CAAAATGGACCATGTGGG -3'
Posted On2015-02-18