Incidental Mutation 'R3419:Olfr672'
ID266966
Institutional Source Beutler Lab
Gene Symbol Olfr672
Ensembl Gene ENSMUSG00000051172
Gene Nameolfactory receptor 672
SynonymsMOR32-4, GA_x6K02T2PBJ9-7625746-7624808
MMRRC Submission 040637-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3419 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104995760-105002029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104996520 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 128 (I128T)
Ref Sequence ENSEMBL: ENSMUSP00000149704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050599] [ENSMUST00000213942]
Predicted Effect probably damaging
Transcript: ENSMUST00000050599
AA Change: I128T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054607
Gene: ENSMUSG00000051172
AA Change: I128T

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 9.1e-111 PFAM
Pfam:7TM_GPCR_Srsx 37 304 4.8e-7 PFAM
Pfam:7tm_1 43 293 5.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211761
AA Change: I128T
Predicted Effect probably damaging
Transcript: ENSMUST00000213942
AA Change: I128T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Ankrd26 A G 6: 118,535,107 L518P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Baz1a T C 12: 54,946,899 K181E probably benign Het
Bend3 T C 10: 43,509,982 S124P probably damaging Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
Dmbx1 G C 4: 115,920,676 R64G probably benign Het
Dpy19l2 T C 9: 24,581,205 E699G probably damaging Het
Eef2k T A 7: 120,885,870 M320K probably damaging Het
Exoc5 A T 14: 49,023,278 N377K probably damaging Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fchsd2 T A 7: 101,278,660 probably null Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gm17093 A G 14: 44,521,590 I190V unknown Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Hoxd10 A G 2: 74,692,577 K200E probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lacc1 T G 14: 77,034,881 E158D probably benign Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mapk6 T C 9: 75,397,757 E126G probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Olfr146 C T 9: 39,019,076 C155Y probably benign Het
Olfr93 A T 17: 37,151,351 V53E probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Paqr3 A G 5: 97,099,700 L183P probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pik3r1 T C 13: 101,692,215 D25G probably benign Het
Poc5 A T 13: 96,404,417 T365S possibly damaging Het
Polr3a A G 14: 24,467,035 L716P probably damaging Het
Ppp1r3a A T 6: 14,719,414 D500E probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Snrnp48 G A 13: 38,221,359 D248N possibly damaging Het
St6galnac4 A G 2: 32,595,731 T217A probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tmem30c A G 16: 57,277,668 V130A probably benign Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Tulp2 T A 7: 45,518,752 M196K possibly damaging Het
Unc5b G A 10: 60,778,814 R235W probably damaging Het
Vmn1r175 A T 7: 23,808,650 M184K probably damaging Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Vmn2r9 A C 5: 108,846,433 M450R probably damaging Het
Wdr60 C T 12: 116,224,977 V666I probably benign Het
Other mutations in Olfr672
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Olfr672 APN 7 104996721 missense probably damaging 1.00
PIT4151001:Olfr672 UTSW 7 104996217 missense probably damaging 1.00
R0396:Olfr672 UTSW 7 104996706 missense probably damaging 0.99
R0632:Olfr672 UTSW 7 104996703 missense probably benign 0.00
R1490:Olfr672 UTSW 7 104996493 missense possibly damaging 0.95
R1781:Olfr672 UTSW 7 104996108 missense possibly damaging 0.80
R2251:Olfr672 UTSW 7 104996595 missense probably damaging 1.00
R3625:Olfr672 UTSW 7 104995984 missense probably benign 0.17
R4093:Olfr672 UTSW 7 104996635 missense probably benign 0.01
R4620:Olfr672 UTSW 7 104996623 missense probably damaging 1.00
R4890:Olfr672 UTSW 7 104996104 missense probably benign 0.15
R5338:Olfr672 UTSW 7 104996307 missense possibly damaging 0.61
R5934:Olfr672 UTSW 7 104996178 missense probably damaging 1.00
R6712:Olfr672 UTSW 7 104996418 missense possibly damaging 0.92
R7620:Olfr672 UTSW 7 104996755 missense possibly damaging 0.64
Z1088:Olfr672 UTSW 7 104996454 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACATGCCAGTCGAGCAATG -3'
(R):5'- ACCAACCTATGTTCTACTTACTGG -3'

Sequencing Primer
(F):5'- AATGCCCATGTGCTCACAGTATG -3'
(R):5'- CCATACTGGCTGTTACTGACTTGG -3'
Posted On2015-02-18