Incidental Mutation 'R3419:Baz1a'
ID266978
Institutional Source Beutler Lab
Gene Symbol Baz1a
Ensembl Gene ENSMUSG00000035021
Gene Namebromodomain adjacent to zinc finger domain 1A
SynonymsWcrf180, Acf1, Gtl5
MMRRC Submission 040637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3419 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location54892989-55014348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54946899 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 181 (K181E)
Ref Sequence ENSEMBL: ENSMUSP00000133478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038926] [ENSMUST00000173433]
Predicted Effect probably benign
Transcript: ENSMUST00000038926
AA Change: K181E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000039757
Gene: ENSMUSG00000035021
AA Change: K181E

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 23 122 4.4e-36 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
Pfam:DDT 423 485 2.3e-14 PFAM
low complexity region 519 530 N/A INTRINSIC
Pfam:WHIM1 593 641 1.5e-8 PFAM
low complexity region 658 696 N/A INTRINSIC
low complexity region 725 738 N/A INTRINSIC
low complexity region 774 796 N/A INTRINSIC
low complexity region 861 873 N/A INTRINSIC
Pfam:WHIM3 894 932 2e-16 PFAM
low complexity region 1058 1073 N/A INTRINSIC
PHD 1151 1197 9.46e-15 SMART
RING 1152 1196 6.88e-1 SMART
low complexity region 1214 1257 N/A INTRINSIC
BROMO 1426 1534 2.18e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173176
Predicted Effect probably benign
Transcript: ENSMUST00000173433
AA Change: K181E

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000133478
Gene: ENSMUSG00000035021
AA Change: K181E

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 22 122 1.1e-37 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
DDT 422 487 1.54e-19 SMART
low complexity region 518 529 N/A INTRINSIC
Pfam:WHIM1 592 640 1.8e-8 PFAM
low complexity region 657 695 N/A INTRINSIC
low complexity region 722 735 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 858 870 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
PHD 1148 1194 9.46e-15 SMART
RING 1149 1193 6.88e-1 SMART
low complexity region 1211 1254 N/A INTRINSIC
BROMO 1423 1531 2.18e-31 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The BAZ1A gene encodes the accessory subunit of the ATP-dependent chromatin assembly factor (ACF), a member of the ISWI ('imitation switch') family of chromatin remodeling complexes (summarized by Racki et al., 2009 [PubMed 20033039]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and able to repair meiotic double-strand breaks but exhibit teratospermia, oligospermia, asthenospermia, and male infertility due to impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Ankrd26 A G 6: 118,535,107 L518P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Bend3 T C 10: 43,509,982 S124P probably damaging Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
Dmbx1 G C 4: 115,920,676 R64G probably benign Het
Dpy19l2 T C 9: 24,581,205 E699G probably damaging Het
Eef2k T A 7: 120,885,870 M320K probably damaging Het
Exoc5 A T 14: 49,023,278 N377K probably damaging Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fchsd2 T A 7: 101,278,660 probably null Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gm17093 A G 14: 44,521,590 I190V unknown Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Hoxd10 A G 2: 74,692,577 K200E probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lacc1 T G 14: 77,034,881 E158D probably benign Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mapk6 T C 9: 75,397,757 E126G probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Olfr146 C T 9: 39,019,076 C155Y probably benign Het
Olfr672 A G 7: 104,996,520 I128T probably damaging Het
Olfr93 A T 17: 37,151,351 V53E probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Paqr3 A G 5: 97,099,700 L183P probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pik3r1 T C 13: 101,692,215 D25G probably benign Het
Poc5 A T 13: 96,404,417 T365S possibly damaging Het
Polr3a A G 14: 24,467,035 L716P probably damaging Het
Ppp1r3a A T 6: 14,719,414 D500E probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Snrnp48 G A 13: 38,221,359 D248N possibly damaging Het
St6galnac4 A G 2: 32,595,731 T217A probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tmem30c A G 16: 57,277,668 V130A probably benign Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Tulp2 T A 7: 45,518,752 M196K possibly damaging Het
Unc5b G A 10: 60,778,814 R235W probably damaging Het
Vmn1r175 A T 7: 23,808,650 M184K probably damaging Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Vmn2r9 A C 5: 108,846,433 M450R probably damaging Het
Wdr60 C T 12: 116,224,977 V666I probably benign Het
Other mutations in Baz1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Baz1a APN 12 54916731 missense probably benign
IGL01138:Baz1a APN 12 54930325 missense probably damaging 1.00
IGL01298:Baz1a APN 12 54954809 missense probably damaging 1.00
IGL02639:Baz1a APN 12 54896025 splice site probably benign
IGL02995:Baz1a APN 12 54900447 missense probably damaging 1.00
IGL03001:Baz1a APN 12 54923111 missense possibly damaging 0.50
IGL03104:Baz1a APN 12 54894958 missense probably damaging 1.00
IGL03135:Baz1a APN 12 54929590 missense probably damaging 1.00
IGL03151:Baz1a APN 12 54909149 critical splice acceptor site probably null
IGL03235:Baz1a APN 12 54898535 missense probably damaging 1.00
IGL03240:Baz1a APN 12 54927567 nonsense probably null
Flavia UTSW 12 54975308 missense probably damaging 1.00
gumdrops UTSW 12 54900448 missense probably damaging 1.00
Kilter UTSW 12 54900532 missense probably damaging 0.99
Kisses UTSW 12 54975137 missense probably damaging 1.00
Smootch UTSW 12 54911385 missense probably damaging 1.00
PIT4458001:Baz1a UTSW 12 54930310 missense probably benign 0.03
R0127:Baz1a UTSW 12 54898706 missense possibly damaging 0.93
R0183:Baz1a UTSW 12 54911387 missense probably damaging 1.00
R0393:Baz1a UTSW 12 54918436 critical splice donor site probably null
R0532:Baz1a UTSW 12 54934820 missense possibly damaging 0.55
R0614:Baz1a UTSW 12 54941519 nonsense probably null
R0626:Baz1a UTSW 12 54975270 missense probably damaging 0.99
R0654:Baz1a UTSW 12 54911397 missense probably benign 0.01
R0782:Baz1a UTSW 12 54894488 missense probably damaging 1.00
R0826:Baz1a UTSW 12 54930312 nonsense probably null
R0855:Baz1a UTSW 12 54900563 splice site probably benign
R0927:Baz1a UTSW 12 54894988 missense probably damaging 1.00
R0941:Baz1a UTSW 12 54898431 missense probably benign 0.00
R1079:Baz1a UTSW 12 54895000 missense possibly damaging 0.91
R1157:Baz1a UTSW 12 54929564 missense probably damaging 1.00
R1647:Baz1a UTSW 12 54975198 missense probably damaging 1.00
R1731:Baz1a UTSW 12 54918545 missense possibly damaging 0.83
R1739:Baz1a UTSW 12 54898788 nonsense probably null
R1762:Baz1a UTSW 12 54909020 missense probably damaging 1.00
R1770:Baz1a UTSW 12 54898508 missense probably damaging 1.00
R1968:Baz1a UTSW 12 54900337 missense possibly damaging 0.91
R2037:Baz1a UTSW 12 54929646 missense probably damaging 1.00
R2111:Baz1a UTSW 12 54911385 missense probably damaging 1.00
R2215:Baz1a UTSW 12 54975369 nonsense probably null
R2282:Baz1a UTSW 12 54916812 nonsense probably null
R2875:Baz1a UTSW 12 54923119 missense probably damaging 1.00
R2890:Baz1a UTSW 12 54898517 missense probably benign
R2971:Baz1a UTSW 12 54923439 missense probably damaging 1.00
R3404:Baz1a UTSW 12 54916989 missense probably benign 0.00
R3699:Baz1a UTSW 12 54917046 missense probably benign 0.09
R3899:Baz1a UTSW 12 54934804 missense probably benign 0.01
R3927:Baz1a UTSW 12 54921143 missense possibly damaging 0.68
R4050:Baz1a UTSW 12 54929619 missense probably benign 0.00
R4072:Baz1a UTSW 12 54941560 missense probably benign 0.18
R4196:Baz1a UTSW 12 54911415 missense probably damaging 1.00
R4289:Baz1a UTSW 12 54900448 missense probably damaging 1.00
R4455:Baz1a UTSW 12 54911368 missense probably benign 0.26
R4583:Baz1a UTSW 12 54922540 missense probably damaging 0.99
R4622:Baz1a UTSW 12 54941515 missense probably benign 0.00
R4807:Baz1a UTSW 12 54898482 missense probably benign 0.28
R4998:Baz1a UTSW 12 54975137 missense probably damaging 1.00
R5239:Baz1a UTSW 12 54898344 missense probably damaging 0.99
R5379:Baz1a UTSW 12 54894348 missense probably damaging 1.00
R5408:Baz1a UTSW 12 54923050 missense probably damaging 1.00
R5678:Baz1a UTSW 12 54900532 missense probably damaging 0.99
R5810:Baz1a UTSW 12 54927715 intron probably benign
R6092:Baz1a UTSW 12 54909083 missense possibly damaging 0.88
R6317:Baz1a UTSW 12 54954800 missense possibly damaging 0.92
R6332:Baz1a UTSW 12 54918554 missense probably benign 0.01
R6803:Baz1a UTSW 12 54941555 missense probably null 0.99
R7185:Baz1a UTSW 12 54975308 missense probably damaging 1.00
R7248:Baz1a UTSW 12 54900508 missense probably damaging 1.00
R7392:Baz1a UTSW 12 54898765 missense probably damaging 1.00
R8009:Baz1a UTSW 12 54895031 nonsense probably null
R8025:Baz1a UTSW 12 54909136 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TCCTCCAGAAGAAAAGCAGG -3'
(R):5'- TCTGGCATAGTAGAGCATACCTTC -3'

Sequencing Primer
(F):5'- ATTACCTGAGTGAAATGTGGGGC -3'
(R):5'- CATAGTAGAGCATACCTTCGAGGC -3'
Posted On2015-02-18