Incidental Mutation 'R3419:Poc5'
ID266984
Institutional Source Beutler Lab
Gene Symbol Poc5
Ensembl Gene ENSMUSG00000021671
Gene NamePOC5 centriolar protein
Synonyms
MMRRC Submission 040637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3419 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location96388294-96417737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96404417 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 365 (T365S)
Ref Sequence ENSEMBL: ENSMUSP00000096898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099295]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099295
AA Change: T365S

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096898
Gene: ENSMUSG00000021671
AA Change: T365S

DomainStartEndE-ValueType
coiled coil region 175 206 N/A INTRINSIC
coiled coil region 300 341 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 418 433 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223478
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Ankrd26 A G 6: 118,535,107 L518P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Baz1a T C 12: 54,946,899 K181E probably benign Het
Bend3 T C 10: 43,509,982 S124P probably damaging Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
Dmbx1 G C 4: 115,920,676 R64G probably benign Het
Dpy19l2 T C 9: 24,581,205 E699G probably damaging Het
Eef2k T A 7: 120,885,870 M320K probably damaging Het
Exoc5 A T 14: 49,023,278 N377K probably damaging Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fchsd2 T A 7: 101,278,660 probably null Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gm17093 A G 14: 44,521,590 I190V unknown Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Hoxd10 A G 2: 74,692,577 K200E probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lacc1 T G 14: 77,034,881 E158D probably benign Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mapk6 T C 9: 75,397,757 E126G probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Olfr146 C T 9: 39,019,076 C155Y probably benign Het
Olfr672 A G 7: 104,996,520 I128T probably damaging Het
Olfr93 A T 17: 37,151,351 V53E probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Paqr3 A G 5: 97,099,700 L183P probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pik3r1 T C 13: 101,692,215 D25G probably benign Het
Polr3a A G 14: 24,467,035 L716P probably damaging Het
Ppp1r3a A T 6: 14,719,414 D500E probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Snrnp48 G A 13: 38,221,359 D248N possibly damaging Het
St6galnac4 A G 2: 32,595,731 T217A probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tmem30c A G 16: 57,277,668 V130A probably benign Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Tulp2 T A 7: 45,518,752 M196K possibly damaging Het
Unc5b G A 10: 60,778,814 R235W probably damaging Het
Vmn1r175 A T 7: 23,808,650 M184K probably damaging Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Vmn2r9 A C 5: 108,846,433 M450R probably damaging Het
Wdr60 C T 12: 116,224,977 V666I probably benign Het
Other mutations in Poc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Poc5 APN 13 96410746 missense probably damaging 1.00
IGL01377:Poc5 APN 13 96401631 missense probably benign 0.35
IGL02981:Poc5 APN 13 96401757 critical splice donor site probably null
IGL03031:Poc5 APN 13 96401615 missense probably benign 0.00
R0348:Poc5 UTSW 13 96398866 missense probably null 1.00
R1533:Poc5 UTSW 13 96391644 missense probably damaging 0.96
R1881:Poc5 UTSW 13 96398731 missense probably benign 0.21
R2171:Poc5 UTSW 13 96410749 missense probably damaging 1.00
R2337:Poc5 UTSW 13 96410603 missense probably damaging 0.98
R3736:Poc5 UTSW 13 96396816 missense probably damaging 1.00
R4554:Poc5 UTSW 13 96403021 missense probably benign 0.40
R5223:Poc5 UTSW 13 96402955 missense probably benign 0.20
R5436:Poc5 UTSW 13 96396813 missense probably damaging 1.00
R6089:Poc5 UTSW 13 96396671 missense probably damaging 1.00
R6700:Poc5 UTSW 13 96394495 missense probably benign 0.00
R7345:Poc5 UTSW 13 96396796 missense probably damaging 1.00
R7354:Poc5 UTSW 13 96394525 missense probably benign 0.02
R7363:Poc5 UTSW 13 96404417 missense possibly damaging 0.88
R7454:Poc5 UTSW 13 96400832 missense possibly damaging 0.93
R7773:Poc5 UTSW 13 96410635 missense probably damaging 1.00
R7786:Poc5 UTSW 13 96404519 missense possibly damaging 0.55
R7953:Poc5 UTSW 13 96402900 missense probably benign 0.27
X0019:Poc5 UTSW 13 96394548 frame shift probably null
X0024:Poc5 UTSW 13 96394548 frame shift probably null
X0034:Poc5 UTSW 13 96394548 frame shift probably null
X0035:Poc5 UTSW 13 96394548 frame shift probably null
X0036:Poc5 UTSW 13 96394548 frame shift probably null
X0037:Poc5 UTSW 13 96394548 frame shift probably null
X0038:Poc5 UTSW 13 96394548 frame shift probably null
X0039:Poc5 UTSW 13 96394548 frame shift probably null
X0040:Poc5 UTSW 13 96394548 frame shift probably null
X0052:Poc5 UTSW 13 96394548 frame shift probably null
X0053:Poc5 UTSW 13 96394548 frame shift probably null
X0054:Poc5 UTSW 13 96394548 frame shift probably null
X0058:Poc5 UTSW 13 96394548 frame shift probably null
X0060:Poc5 UTSW 13 96394548 frame shift probably null
X0061:Poc5 UTSW 13 96394548 frame shift probably null
X0062:Poc5 UTSW 13 96394548 frame shift probably null
X0063:Poc5 UTSW 13 96394548 frame shift probably null
Z1176:Poc5 UTSW 13 96401722 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CCTCTGAAGTCCATAGTGGTTG -3'
(R):5'- AGAAGAGGCCGATGTAGCTC -3'

Sequencing Primer
(F):5'- GTCCATAGTGGTTGATACTGACATC -3'
(R):5'- ATGTAGCTCCGGCCGAG -3'
Posted On2015-02-18