Incidental Mutation 'R3419:Polr3a'
ID266985
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Namepolymerase (RNA) III (DNA directed) polypeptide A
SynonymsRPC1, 9330175N20Rik, RPC155
MMRRC Submission 040637-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3419 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location24448696-24487058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24467035 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 716 (L716P)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
Predicted Effect probably damaging
Transcript: ENSMUST00000026322
AA Change: L716P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: L716P

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225526
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Ankrd26 A G 6: 118,535,107 L518P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Baz1a T C 12: 54,946,899 K181E probably benign Het
Bend3 T C 10: 43,509,982 S124P probably damaging Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
Dmbx1 G C 4: 115,920,676 R64G probably benign Het
Dpy19l2 T C 9: 24,581,205 E699G probably damaging Het
Eef2k T A 7: 120,885,870 M320K probably damaging Het
Exoc5 A T 14: 49,023,278 N377K probably damaging Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fchsd2 T A 7: 101,278,660 probably null Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gm17093 A G 14: 44,521,590 I190V unknown Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Hoxd10 A G 2: 74,692,577 K200E probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lacc1 T G 14: 77,034,881 E158D probably benign Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mapk6 T C 9: 75,397,757 E126G probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Olfr146 C T 9: 39,019,076 C155Y probably benign Het
Olfr672 A G 7: 104,996,520 I128T probably damaging Het
Olfr93 A T 17: 37,151,351 V53E probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Paqr3 A G 5: 97,099,700 L183P probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pik3r1 T C 13: 101,692,215 D25G probably benign Het
Poc5 A T 13: 96,404,417 T365S possibly damaging Het
Ppp1r3a A T 6: 14,719,414 D500E probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Snrnp48 G A 13: 38,221,359 D248N possibly damaging Het
St6galnac4 A G 2: 32,595,731 T217A probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tmem30c A G 16: 57,277,668 V130A probably benign Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Tulp2 T A 7: 45,518,752 M196K possibly damaging Het
Unc5b G A 10: 60,778,814 R235W probably damaging Het
Vmn1r175 A T 7: 23,808,650 M184K probably damaging Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Vmn2r9 A C 5: 108,846,433 M450R probably damaging Het
Wdr60 C T 12: 116,224,977 V666I probably benign Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24475863 missense probably benign 0.35
IGL00974:Polr3a APN 14 24479424 missense probably benign 0.05
IGL01348:Polr3a APN 14 24461763 missense probably damaging 1.00
IGL01464:Polr3a APN 14 24470681 splice site probably benign
IGL01785:Polr3a APN 14 24484120 nonsense probably null
IGL01786:Polr3a APN 14 24484120 nonsense probably null
IGL01936:Polr3a APN 14 24479188 missense probably damaging 1.00
IGL02095:Polr3a APN 14 24454610 missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24475823 missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24470877 missense probably benign 0.07
IGL02961:Polr3a APN 14 24467040 nonsense probably null
IGL03069:Polr3a APN 14 24461740 missense probably damaging 0.99
R0001:Polr3a UTSW 14 24452189 splice site probably benign
R0048:Polr3a UTSW 14 24469255 splice site probably benign
R0157:Polr3a UTSW 14 24479186 missense probably damaging 0.99
R0445:Polr3a UTSW 14 24454921 missense probably benign 0.00
R0449:Polr3a UTSW 14 24484466 missense probably damaging 0.99
R0597:Polr3a UTSW 14 24484134 missense probably benign 0.29
R0604:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0644:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0703:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0754:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0767:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0816:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0817:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0819:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0840:Polr3a UTSW 14 24452200 missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24452548 missense probably null 0.98
R1644:Polr3a UTSW 14 24470624 missense probably damaging 1.00
R1699:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R1704:Polr3a UTSW 14 24484120 nonsense probably null
R2363:Polr3a UTSW 14 24475892 splice site probably null
R3934:Polr3a UTSW 14 24476101 missense probably benign 0.30
R4296:Polr3a UTSW 14 24453196 missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24452508 splice site probably null
R4690:Polr3a UTSW 14 24464281 missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24452624 missense probably benign 0.11
R4947:Polr3a UTSW 14 24482464 missense probably benign 0.00
R5232:Polr3a UTSW 14 24453211 missense probably benign 0.00
R5263:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24465387 splice site probably null
R5841:Polr3a UTSW 14 24450698 missense probably benign 0.00
R6408:Polr3a UTSW 14 24486871 critical splice donor site probably null
R6704:Polr3a UTSW 14 24461842 missense probably damaging 1.00
R7136:Polr3a UTSW 14 24461815 missense probably damaging 1.00
R7307:Polr3a UTSW 14 24459987 missense probably benign 0.03
R7368:Polr3a UTSW 14 24467076 missense probably damaging 0.98
R7800:Polr3a UTSW 14 24484387 missense probably null 0.83
Z1088:Polr3a UTSW 14 24479724 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCTCTGCATGGCTCTTAGC -3'
(R):5'- AGCGCTCTCTTCATTGAGTTAC -3'

Sequencing Primer
(F):5'- GCTCTTAGCCCATCCCCAAG -3'
(R):5'- ATTGAGTTACACCCCCAGTCTGAC -3'
Posted On2015-02-18