Incidental Mutation 'R3419:Polr3a'
ID 266985
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Name polymerase (RNA) III (DNA directed) polypeptide A
Synonyms RPC155, 9330175N20Rik, RPC1
MMRRC Submission 040637-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3419 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 24498764-24537126 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24517103 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 716 (L716P)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
AlphaFold B2RXC6
Predicted Effect probably damaging
Transcript: ENSMUST00000026322
AA Change: L716P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: L716P

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225526
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,271,082 (GRCm39) Q42R probably benign Het
Ankrd26 A G 6: 118,512,068 (GRCm39) L518P probably damaging Het
Armc9 T C 1: 86,122,060 (GRCm39) L395P probably damaging Het
Baz1a T C 12: 54,993,684 (GRCm39) K181E probably benign Het
Bend3 T C 10: 43,385,978 (GRCm39) S124P probably damaging Het
Cdh5 C T 8: 104,856,002 (GRCm39) R312C probably damaging Het
Col6a3 T C 1: 90,731,813 (GRCm39) D873G probably benign Het
Dmbx1 G C 4: 115,777,873 (GRCm39) R64G probably benign Het
Dpy19l2 T C 9: 24,492,501 (GRCm39) E699G probably damaging Het
Dync2i1 C T 12: 116,188,597 (GRCm39) V666I probably benign Het
Eef2k T A 7: 120,485,093 (GRCm39) M320K probably damaging Het
Exoc5 A T 14: 49,260,735 (GRCm39) N377K probably damaging Het
Fam20c A T 5: 138,743,623 (GRCm39) N220Y probably damaging Het
Fchsd2 T A 7: 100,927,867 (GRCm39) probably null Het
Flrt2 A G 12: 95,747,378 (GRCm39) Y572C probably damaging Het
Gm17093 A G 14: 44,759,047 (GRCm39) I190V unknown Het
Gsto1 T C 19: 47,846,344 (GRCm39) F64L probably benign Het
Gucy1a1 A G 3: 82,013,440 (GRCm39) S401P probably damaging Het
Hoxd10 A G 2: 74,522,921 (GRCm39) K200E probably benign Het
Kcnj13 T C 1: 87,314,641 (GRCm39) T194A probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lacc1 T G 14: 77,272,321 (GRCm39) E158D probably benign Het
Lyn A T 4: 3,746,833 (GRCm39) I204F probably damaging Het
Mapk6 T C 9: 75,305,039 (GRCm39) E126G probably damaging Het
Mbd6 C G 10: 127,122,372 (GRCm39) R152P probably null Het
Or2h1b A T 17: 37,462,242 (GRCm39) V53E probably damaging Het
Or52e15 A G 7: 104,645,727 (GRCm39) I128T probably damaging Het
Or8g17 C T 9: 38,930,372 (GRCm39) C155Y probably benign Het
P2ry1 T C 3: 60,911,133 (GRCm39) F91L probably damaging Het
Paqr3 A G 5: 97,247,559 (GRCm39) L183P probably damaging Het
Pcdh15 C A 10: 74,420,054 (GRCm39) D1166E probably benign Het
Pik3r1 T C 13: 101,828,723 (GRCm39) D25G probably benign Het
Poc5 A T 13: 96,540,925 (GRCm39) T365S possibly damaging Het
Ppp1r3a A T 6: 14,719,413 (GRCm39) D500E probably benign Het
Ptcd3 A T 6: 71,860,470 (GRCm39) I579K possibly damaging Het
Rnf168 A G 16: 32,118,010 (GRCm39) N524D probably benign Het
Scn7a AT ATT 2: 66,531,239 (GRCm39) probably null Het
Sel1l A G 12: 91,776,776 (GRCm39) W689R probably damaging Het
Serpinb13 T C 1: 106,926,657 (GRCm39) S218P probably damaging Het
Serpini1 A G 3: 75,547,589 (GRCm39) Y367C probably damaging Het
Snrnp48 G A 13: 38,405,335 (GRCm39) D248N possibly damaging Het
St6galnac4 A G 2: 32,485,743 (GRCm39) T217A probably damaging Het
Tdrd1 T A 19: 56,819,663 (GRCm39) N54K possibly damaging Het
Tmem30c A G 16: 57,098,031 (GRCm39) V130A probably benign Het
Trpa1 T C 1: 14,944,605 (GRCm39) I1046M probably benign Het
Tulp2 T A 7: 45,168,176 (GRCm39) M196K possibly damaging Het
Unc5b G A 10: 60,614,593 (GRCm39) R235W probably damaging Het
Vmn1r175 A T 7: 23,508,075 (GRCm39) M184K probably damaging Het
Vmn2r2 A T 3: 64,024,320 (GRCm39) F754I probably benign Het
Vmn2r9 A C 5: 108,994,299 (GRCm39) M450R probably damaging Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24,525,931 (GRCm39) missense probably benign 0.35
IGL00974:Polr3a APN 14 24,529,492 (GRCm39) missense probably benign 0.05
IGL01348:Polr3a APN 14 24,511,831 (GRCm39) missense probably damaging 1.00
IGL01464:Polr3a APN 14 24,520,749 (GRCm39) splice site probably benign
IGL01785:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01786:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01936:Polr3a APN 14 24,529,256 (GRCm39) missense probably damaging 1.00
IGL02095:Polr3a APN 14 24,504,678 (GRCm39) missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24,525,891 (GRCm39) missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24,520,945 (GRCm39) missense probably benign 0.07
IGL02961:Polr3a APN 14 24,517,108 (GRCm39) nonsense probably null
IGL03069:Polr3a APN 14 24,511,808 (GRCm39) missense probably damaging 0.99
R0001:Polr3a UTSW 14 24,502,257 (GRCm39) splice site probably benign
R0048:Polr3a UTSW 14 24,519,323 (GRCm39) splice site probably benign
R0157:Polr3a UTSW 14 24,529,254 (GRCm39) missense probably damaging 0.99
R0445:Polr3a UTSW 14 24,504,989 (GRCm39) missense probably benign 0.00
R0449:Polr3a UTSW 14 24,534,534 (GRCm39) missense probably damaging 0.99
R0597:Polr3a UTSW 14 24,534,202 (GRCm39) missense probably benign 0.29
R0604:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0644:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0703:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0754:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0767:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0816:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0817:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0819:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0840:Polr3a UTSW 14 24,502,268 (GRCm39) missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24,502,616 (GRCm39) missense probably null 0.98
R1644:Polr3a UTSW 14 24,520,692 (GRCm39) missense probably damaging 1.00
R1699:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R1704:Polr3a UTSW 14 24,534,188 (GRCm39) nonsense probably null
R2363:Polr3a UTSW 14 24,525,960 (GRCm39) splice site probably null
R3934:Polr3a UTSW 14 24,526,169 (GRCm39) missense probably benign 0.30
R4296:Polr3a UTSW 14 24,503,264 (GRCm39) missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24,502,576 (GRCm39) splice site probably null
R4690:Polr3a UTSW 14 24,514,349 (GRCm39) missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24,502,692 (GRCm39) missense probably benign 0.11
R4947:Polr3a UTSW 14 24,532,532 (GRCm39) missense probably benign 0.00
R5232:Polr3a UTSW 14 24,503,279 (GRCm39) missense probably benign 0.00
R5263:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24,515,455 (GRCm39) splice site probably null
R5841:Polr3a UTSW 14 24,500,766 (GRCm39) missense probably benign 0.00
R6408:Polr3a UTSW 14 24,536,939 (GRCm39) critical splice donor site probably null
R6704:Polr3a UTSW 14 24,511,910 (GRCm39) missense probably damaging 1.00
R7136:Polr3a UTSW 14 24,511,883 (GRCm39) missense probably damaging 1.00
R7307:Polr3a UTSW 14 24,510,055 (GRCm39) missense probably benign 0.03
R7368:Polr3a UTSW 14 24,517,144 (GRCm39) missense probably damaging 0.98
R7800:Polr3a UTSW 14 24,534,455 (GRCm39) missense probably null 0.83
R8753:Polr3a UTSW 14 24,513,702 (GRCm39) nonsense probably null
R8785:Polr3a UTSW 14 24,502,383 (GRCm39) missense probably benign 0.06
R8848:Polr3a UTSW 14 24,500,834 (GRCm39) missense probably damaging 1.00
R9025:Polr3a UTSW 14 24,519,479 (GRCm39) missense probably damaging 1.00
R9139:Polr3a UTSW 14 24,519,416 (GRCm39) missense probably damaging 1.00
R9264:Polr3a UTSW 14 24,520,899 (GRCm39) missense probably benign
R9309:Polr3a UTSW 14 24,510,067 (GRCm39) missense probably benign
R9363:Polr3a UTSW 14 24,500,831 (GRCm39) missense probably damaging 1.00
R9526:Polr3a UTSW 14 24,503,313 (GRCm39) missense probably benign 0.00
R9585:Polr3a UTSW 14 24,502,289 (GRCm39) missense probably damaging 1.00
Z1088:Polr3a UTSW 14 24,529,792 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCTCTGCATGGCTCTTAGC -3'
(R):5'- AGCGCTCTCTTCATTGAGTTAC -3'

Sequencing Primer
(F):5'- GCTCTTAGCCCATCCCCAAG -3'
(R):5'- ATTGAGTTACACCCCCAGTCTGAC -3'
Posted On 2015-02-18