Incidental Mutation 'R3419:Olfr93'
ID266990
Institutional Source Beutler Lab
Gene Symbol Olfr93
Ensembl Gene ENSMUSG00000091601
Gene Nameolfactory receptor 93
SynonymsGA_x6K02T2PSCP-1592036-1591098, MOR256-39P
MMRRC Submission 040637-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R3419 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37140423-37161494 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37151351 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 53 (V53E)
Ref Sequence ENSEMBL: ENSMUSP00000146548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171679] [ENSMUST00000208003] [ENSMUST00000219235]
Predicted Effect probably damaging
Transcript: ENSMUST00000171679
AA Change: V207E

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125907
Gene: ENSMUSG00000091601
AA Change: V207E

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.7e-50 PFAM
Pfam:7tm_1 39 288 3.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208003
AA Change: V53E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000219235
AA Change: V207E

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A G 6: 133,294,119 Q42R probably benign Het
Ankrd26 A G 6: 118,535,107 L518P probably damaging Het
Armc9 T C 1: 86,194,338 L395P probably damaging Het
Baz1a T C 12: 54,946,899 K181E probably benign Het
Bend3 T C 10: 43,509,982 S124P probably damaging Het
Cdh5 C T 8: 104,129,370 R312C probably damaging Het
Col6a3 T C 1: 90,804,091 D873G probably benign Het
Dmbx1 G C 4: 115,920,676 R64G probably benign Het
Dpy19l2 T C 9: 24,581,205 E699G probably damaging Het
Eef2k T A 7: 120,885,870 M320K probably damaging Het
Exoc5 A T 14: 49,023,278 N377K probably damaging Het
Fam20c A T 5: 138,757,868 N220Y probably damaging Het
Fchsd2 T A 7: 101,278,660 probably null Het
Flrt2 A G 12: 95,780,604 Y572C probably damaging Het
Gm17093 A G 14: 44,521,590 I190V unknown Het
Gsto1 T C 19: 47,857,905 F64L probably benign Het
Gucy1a1 A G 3: 82,106,133 S401P probably damaging Het
Hoxd10 A G 2: 74,692,577 K200E probably benign Het
Kcnj13 T C 1: 87,386,919 T194A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lacc1 T G 14: 77,034,881 E158D probably benign Het
Lyn A T 4: 3,746,833 I204F probably damaging Het
Mapk6 T C 9: 75,397,757 E126G probably damaging Het
Mbd6 C G 10: 127,286,503 R152P probably null Het
Olfr146 C T 9: 39,019,076 C155Y probably benign Het
Olfr672 A G 7: 104,996,520 I128T probably damaging Het
P2ry1 T C 3: 61,003,712 F91L probably damaging Het
Paqr3 A G 5: 97,099,700 L183P probably damaging Het
Pcdh15 C A 10: 74,584,222 D1166E probably benign Het
Pik3r1 T C 13: 101,692,215 D25G probably benign Het
Poc5 A T 13: 96,404,417 T365S possibly damaging Het
Polr3a A G 14: 24,467,035 L716P probably damaging Het
Ppp1r3a A T 6: 14,719,414 D500E probably benign Het
Ptcd3 A T 6: 71,883,486 I579K possibly damaging Het
Rnf168 A G 16: 32,299,192 N524D probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Sel1l A G 12: 91,810,002 W689R probably damaging Het
Serpinb13 T C 1: 106,998,927 S218P probably damaging Het
Serpini1 A G 3: 75,640,282 Y367C probably damaging Het
Snrnp48 G A 13: 38,221,359 D248N possibly damaging Het
St6galnac4 A G 2: 32,595,731 T217A probably damaging Het
Tdrd1 T A 19: 56,831,231 N54K possibly damaging Het
Tmem30c A G 16: 57,277,668 V130A probably benign Het
Trpa1 T C 1: 14,874,381 I1046M probably benign Het
Tulp2 T A 7: 45,518,752 M196K possibly damaging Het
Unc5b G A 10: 60,778,814 R235W probably damaging Het
Vmn1r175 A T 7: 23,808,650 M184K probably damaging Het
Vmn2r2 A T 3: 64,116,899 F754I probably benign Het
Vmn2r9 A C 5: 108,846,433 M450R probably damaging Het
Wdr60 C T 12: 116,224,977 V666I probably benign Het
Other mutations in Olfr93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Olfr93 APN 17 37151441 missense probably damaging 1.00
IGL02369:Olfr93 APN 17 37151774 missense probably damaging 1.00
IGL02392:Olfr93 APN 17 37151088 missense probably benign 0.03
IGL02516:Olfr93 APN 17 37151272 missense possibly damaging 0.95
IGL03089:Olfr93 APN 17 37151643 missense probably damaging 1.00
PIT4515001:Olfr93 UTSW 17 37151379 missense probably benign
R0396:Olfr93 UTSW 17 37151555 missense probably damaging 1.00
R2276:Olfr93 UTSW 17 37151254 nonsense probably null
R2278:Olfr93 UTSW 17 37151254 nonsense probably null
R4254:Olfr93 UTSW 17 37151639 missense possibly damaging 0.90
R4353:Olfr93 UTSW 17 37151337 missense probably damaging 1.00
R4530:Olfr93 UTSW 17 37151607 missense possibly damaging 0.84
R4666:Olfr93 UTSW 17 37151379 missense possibly damaging 0.61
R5583:Olfr93 UTSW 17 37151594 missense probably benign 0.00
R5834:Olfr93 UTSW 17 37151799 missense probably damaging 1.00
R6348:Olfr93 UTSW 17 37151606 missense probably damaging 0.96
R6461:Olfr93 UTSW 17 37151471 missense probably damaging 1.00
R6788:Olfr93 UTSW 17 37151822 missense probably damaging 0.98
R7969:Olfr93 UTSW 17 37151186 missense possibly damaging 0.95
R8374:Olfr93 UTSW 17 37151745 missense probably damaging 0.97
Z1177:Olfr93 UTSW 17 37151825 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTCTCTCTTGGGCATAGG -3'
(R):5'- TTGACCGCTATGTGGCTGTC -3'

Sequencing Primer
(F):5'- GGATTTTTGGGCTGCAGATAGACAG -3'
(R):5'- CCTGGGCTATAGGTTTGGTCCAATC -3'
Posted On2015-02-18